NM_001754.4:c.529_551dup

RUNX1 · NP_001745.2:p.(Gln185SerfsTer34) · NM_001754.4

GRCh37: chr21:36231832 C>CGGTGGGTTTGTGAAGACAGTGAT · GRCh38: chr21:34859535 C>CGGTGGGTTTGTGAAGACAGTGAT

Gene: RUNX1 Transcript: NM_001754.4

Final call

Pathogenic

PVS1 PM2_Supporting PM5_Supporting

Variant details

Gene

RUNX1

Transcript

NM_001754.4

Protein

NP_001745.2:p.(Gln185SerfsTer34)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

The RUNX1 c.529_551dup (p.(Gln185SerfsTer34)) variant has not been observed in COSMIC and has not been reported in ClinVar; OncoKB classifies this variant as Likely Oncogenic with a likely loss-of-function effect.

This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.

This duplication is predicted to cause a frameshift, p.(Gln185SerfsTer34), and SpliceAI predicts no significant splice impact with a maximum delta score of 0.01, which is consistent with applying PVS1 and PM5_Supporting under the RUNX1 MM-VCEP framework.

Final determination: Under the RUNX1 MM-VCEP point-based framework, a total of 10 points from PVS1 at Very Strong strength plus PM2_Supporting and PM5_Supporting meets the Pathogenic threshold.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PP4	N/A	PP4 is not applicable in the RUNX1 MM-VCEP framework because the FPD/AML phenotype is not considered sufficiently specific for a single genetic etiology.	cspec
PVS1	Met	This duplication causes a frameshift, NM_001754.4:c.529_551dup, predicted to produce p.(Gln185SerfsTer34) in exon 6 of 9 with premature truncation well upstream of the 3' end of RUNX1. RUNX1 loss of function is an established disease mechanism in the MM-VCEP specification, so this finding supports PVS1 at Very Strong strength.	cspec pvs1_gene_context pvs1_variant_assessment
PP1	Not assessed	No segregation data were identified, so co-segregation with RUNX1-related disease cannot be assessed.
PS2	Not assessed	No confirmed de novo occurrence with maternity and paternity established was identified, so PS2 cannot be assessed.
BP2	Not assessed	No cis/trans observation with another pathogenic RUNX1 variant was identified, so BP2 cannot be assessed.
PP5	N/A	PP5 is not used in this VCEP framework.	cspec
PM2	Met	This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is therefore 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.	gnomad_v2 gnomad_v4 cspec
BS3	Not assessed	No variant-specific functional studies demonstrating normal RUNX1 function were identified, so BS3 cannot be applied.	oncokb
PM4	Not met	This variant is a frameshift duplication, not an in-frame deletion/insertion or stop-loss variant, so PM4 does not apply.	cspec pvs1_variant_assessment
BP4	N/A	BP4 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and intronic variants. This variant is a frameshift duplication, so BP4 is not applicable.	cspec spliceai
BP3	N/A	BP3 is not applicable in the RUNX1 MM-VCEP framework.	cspec
PS1	Not assessed	No previously established pathogenic or likely pathogenic variant producing the same amino acid change or the same splice event was identified, so PS1 was not applied.	clinvar vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
PM6	Not assessed	No assumed de novo occurrence in an affected individual was identified, so PM6 cannot be assessed.
PM5	Met	RUNX1 MM-VCEP allows PM5_Supporting for nonsense or frameshift variants downstream of c.98 when splicing is not predicted to be disrupted and PM1 is not applied. This frameshift occurs at c.529_551, which is downstream of c.98, and SpliceAI shows a maximum delta score of 0.01, which is below the less than or equal to 0.20 splice caveat.	cspec spliceai vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
BP6	N/A	BP6 is not used in this VCEP framework.	cspec
BP7	N/A	BP7 in the RUNX1 MM-VCEP framework is defined for synonymous and intronic variants. This variant is a frameshift duplication, so BP7 is not applicable.	cspec spliceai
BP5	N/A	BP5 is not applicable in the RUNX1 MM-VCEP framework.	cspec
PS4	Not assessed	No proband data meeting RUNX1 phenotypic criteria were identified, so PS4 cannot be applied.	clinvar cosmic
BS4	Not assessed	No evidence showing non-segregation with disease in informative meioses was identified, so BS4 cannot be assessed.
BS2	N/A	BS2 is not applicable in the RUNX1 MM-VCEP framework.	cspec
PM1	Not met	Although codon 185 lies within the RUNX1 runt homology domain, available evidence does not support applying PM1 to this truncating frameshift variant. In the reviewed RUNX1 MM-VCEP pilot precedent, a downstream frameshift variant was curated with PVS1 and PM5_Supporting rather than PM1, and the specification states that PM5 should not be combined with PM1.	cspec vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
PP3	N/A	PP3 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and selected intronic variants. This variant is a frameshift duplication, so PP3 is not applicable.	cspec spliceai
PP2	N/A	PP2 is not applicable in the RUNX1 MM-VCEP framework.	cspec
BA1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is 0, which is below the RUNX1 BA1 threshold of greater than or equal to 0.0015, so BA1 is not met.	gnomad_v2 gnomad_v4 cspec
PS3	Not assessed	No variant-specific transactivation assay or qualifying secondary functional assay was identified, so PS3 was not applied.	oncokb
BP1	N/A	BP1 is not applicable in the RUNX1 MM-VCEP framework.	cspec
PM3	N/A	PM3 is not applicable in the RUNX1 MM-VCEP framework.	cspec
BS1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is 0, which is below the RUNX1 BS1 range of 0.00015 to 0.0015, so BS1 is not met.	gnomad_v2 gnomad_v4 cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.