LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-04-19
Case ID: NM_004119.2_c.1792_1793insCTACGTTGATTTCAGAGAATATGA_20260419_210054
Framework: ACMG/AMP 2015
Variant classification summary

NM_004119.2:c.1792_1793insCTACGTTGATTTCAGAGAATATGA

FLT3  · NP_004110.2:p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys)  · NM_004119.2
GRCh37: chr13:28608263 T>TTCATATTCTCTGAAATCAACGTAG  ·  GRCh38: chr13:28034126 T>TTCATATTCTCTGAAATCAACGTAG
Gene: FLT3 Transcript: NM_004119.2
Final call
VUS
PM1_Moderate PM2_Moderate
All criteria require review: For research and educational purposes only.
Variant details
Gene
FLT3
Transcript
NM_004119.2
Protein
NP_004110.2:p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
The FLT3 c.1792_1793insCTACGTTGATTTCAGAGAATATGA (p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; however, OncoKB classifies this specific variant as Likely Oncogenic with a likely gain-of-function effect.
2
This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed population frequency of 0, which is below the 0.1% PM2 threshold.
3
Published studies show that FLT3 internal tandem duplication and related length mutations in the juxtamembrane region are activating, and codons 589-599 form a recurrent cluster; this supports the pathogenic relevance of the E598 region, although a direct functional assay for this exact variant was not identified.
4
SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.08.
Final determination: Two moderate pathogenic criteria (PM1 and PM2) do not meet ACMG/AMP 2015 thresholds for Likely Pathogenic; therefore, this variant is classified as a Variant of Uncertain Significance.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 N/A This in-frame insertion/duplication does not create a nonsense, frameshift, or canonical +/-1,2 splice variant, so the generic PVS1 loss-of-function framework does not apply despite gene-level evidence that FLT3 loss of function can be disease relevant.
pvs1_gene_context pvs1_variant_assessment pvs1_generic_framework
PS1 N/A PS1 applies to a different nucleotide change causing the same established pathogenic amino acid substitution; this variant is an in-frame insertion/duplication rather than a single amino acid substitution, so PS1 is not applicable.
PS2 Not assessed No confirmed de novo data with verified maternity and paternity were identified, so PS2 cannot be assessed.
PS3 Not met Published functional studies support gain-of-function for FLT3 internal tandem duplication and length mutations as a class, but no well-established functional study directly testing this specific p.(Glu598delinsAlaThrLeuIleSerGluAsnMetLys) variant was identified, so PS3 is not met.
oncokb PMID:11090077 PMID:11756186 PMID:12384447 PMID:9737679
PS4 Not assessed No case-control or statistically enriched germline case series data were identified for this variant, so PS4 cannot be assessed.
clinvar cosmic
PM1 Met This variant affects FLT3 residue E598 in the juxtamembrane domain, within the codon 589-599 cluster where 47 of 51 reported FLT3 internal tandem duplications were located; published studies show this region is a recurrent activating hotspot and this supports PM1.
PMID:9737679 PMID:11090077 PMID:11756186 oncokb hotspots
PM2 Met This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the default PM2 threshold of 0.1%.
gnomad_v2 gnomad_v4
PM3 Not assessed No recessive inheritance data or trans observations with another pathogenic variant were identified, so PM3 cannot be assessed.
PM4 Not assessed This is an in-frame protein length change, but the available evidence supports a recurrent activating juxtamembrane duplication mechanism rather than a clearly independent non-repeat PM4 mechanism, so PM4 was not separately applied.
prefetch PMID:9737679
PM5 N/A PM5 applies to a novel missense change at a residue where another missense change is established as pathogenic; this variant is an in-frame insertion/duplication, so PM5 is not applicable.
PM6 Not assessed No assumed de novo occurrence without full parental confirmation was identified, so PM6 cannot be assessed.
PP1 Not assessed No segregation data were identified for this variant, so PP1 cannot be assessed.
PP2 N/A PP2 is a missense criterion and does not apply to this in-frame insertion/duplication.
PP3 Not assessed SpliceAI predicts no significant splice effect with a maximum delta score of 0.08, but no validated protein-level in silico framework was identified for this in-frame insertion/duplication, so PP3 was not applied.
spliceai
PP4 Not assessed No patient phenotype or family history data were provided to establish a highly specific FLT3-associated germline presentation, so PP4 cannot be assessed.
PP5 Not met No pathogenic classification from a germline clinical laboratory source was identified; this variant is absent from ClinVar, so PP5 is not met.
clinvar
BA1 Not met This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the benign BA1 threshold of 1%.
gnomad_v2 gnomad_v4
BS1 Not met This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and is below the benign BS1 threshold of 0.3%.
gnomad_v2 gnomad_v4
BS2 Not assessed No evidence was identified showing this variant in healthy adult individuals in a context where full penetrance would be expected, so BS2 cannot be assessed.
BS3 Not met Available functional studies describe activating effects for FLT3 internal tandem duplication and length mutations rather than normal function for this specific variant, so BS3 is not met.
oncokb PMID:11090077 PMID:11756186 PMID:12384447 PMID:9737679
BS4 Not assessed No non-segregation data were identified for this variant, so BS4 cannot be assessed.
BP1 N/A BP1 is a missense criterion and does not apply to this in-frame insertion/duplication.
BP2 Not assessed No phase data with another pathogenic variant were identified, so BP2 cannot be assessed.
BP3 Not met Although this is an in-frame insertion/duplication, it lies in the FLT3 juxtamembrane region that has published evidence for recurrent activating mutations, so the benign BP3 criterion for repetitive regions without known function is not met.
PMID:9737679 PMID:11090077 PMID:11756186
BP4 Not assessed SpliceAI predicts no significant splice effect with a maximum delta score of 0.08, but no established benign in silico framework was identified for interpreting this in-frame insertion/duplication at the protein level, so BP4 was not applied.
spliceai
BP5 Not assessed No alternate molecular diagnosis explaining the phenotype was identified, so BP5 cannot be assessed.
BP6 Not met No reputable germline source classified this variant as benign or likely benign, and the variant is absent from ClinVar, so BP6 is not met.
clinvar
BP7 N/A BP7 applies to synonymous or certain noncoding variants with no predicted splice impact; this coding in-frame insertion/duplication is not eligible for BP7.
spliceai
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.