LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-04-19
Case ID: NM_004119.2_c.1732_1797dup_20260419_214251
Framework: ACMG/AMP 2015 with custom FLT3 criterion specifications
Variant classification summary

NM_004119.2:c.1732_1797dup

FLT3  · NP_004110.2:p.(Met578_Tyr599dup)  · NM_004119.2
GRCh37: chr13:28608258 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT  ·  GRCh38: chr13:28034121 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT
Gene: FLT3 Transcript: NM_004119.2
Final call
Likely Pathogenic
PM1_Moderate PM2_Moderate PM5_Moderate
All criteria require review: For research and educational purposes only.
Gene
FLT3
Transcript
NM_004119.2
Protein
NP_004110.2:p.(Met578_Tyr599dup)
gnomAD AF
ClinVar
OncoKB
Interpretation summary
Generated evidence synthesis
1
The FLT3 c.1732_1797dup (p.Met578_Tyr599dup) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.
2
This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed population frequency of 0, which is below the default PM2 rarity threshold of 0.1%.
3
The duplicated segment spans the FLT3 juxtamembrane ITD hotspot and includes the classic codon 589-599 activating cluster, which supports hotspot-class evidence, but no exact-variant OncoKB functional assertion was identified for p.Met578_Tyr599dup.
4
SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.18.
Final determination: Three Moderate pathogenic criteria (PM1, PM2, PM5) meet the Likely Pathogenic combination rule.
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 N/A This variant is an in-frame duplication, NM_004119.2:c.1732_1797dup (p.Met578_Tyr599dup), and does not fall into the generic PVS1 null-variant categories of nonsense, frameshift, or canonical ±1,2 splice variants. Although FLT3 loss of function can be a germline disease mechanism, available evidence does not support applying PVS1 to this non-null variant type.
pvs1_gene_context pvs1_variant_assessment
PS1 N/A This variant is an in-frame duplication rather than a single-nucleotide missense substitution, so PS1 is not applicable.
prefetch
PS2 Not assessed No confirmed de novo data were identified, so PS2 was not assessed.
PS3 Not met Available evidence supports FLT3 internal tandem duplications as an activating variant class in the juxtamembrane region, but no exact-variant OncoKB assertion or variant-specific functional study was identified for p.Met578_Tyr599dup. Under the local FLT3 framework, class-level ITD mechanism alone does not meet PS3 for a novel exact event.
oncokb vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n vcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_e
PS4 Not assessed No case-control enrichment or case-series data demonstrating increased prevalence in affected individuals were identified, so PS4 was not assessed.
clinvar cosmic
PM1 Met This variant is an in-frame tandem duplication, p.Met578_Tyr599dup, in the FLT3 juxtamembrane ITD hotspot region. The duplicated segment spans codons 578-599 and includes the classic activating codon 589-599 cluster, where recurrent FLT3 ITDs have been reported; this supports PM1 at Moderate strength under the local FLT3 framework.
prefetch vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n
PM2 Met This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, so the observed population frequency is 0, which is below the default PM2 rarity threshold of 0.1%. This rarity supports PM2.
gnomad_v2 gnomad_v4
PM3 Not assessed No phase or recessive trans observations were identified, so PM3 was not assessed.
PM4 Not met This variant causes an in-frame protein length change, but in the local FLT3 framework canonical juxtamembrane ITD evidence is already captured by PM1 and the FLT3-specific PM5 rule. Available evidence does not provide a separate non-overlapping rationale to apply PM4 independently.
vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n
PM5 Met This variant is a novel in-frame FLT3 tandem duplication in the established juxtamembrane activating ITD hotspot class. The exact duplicated sequence has not been individually curated in ClinVar or OncoKB, but the event is an ITD-class analogue spanning the classic codon 589-599 hotspot, where pathogenic/oncogenic FLT3 ITDs and activating length mutations are already established; this meets the local FLT3-specific PM5 rule at Moderate strength.
clinvar oncokb vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n vcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_e
PM6 Not assessed No assumed de novo observation without confirmed maternity and paternity was identified, so PM6 was not assessed.
PP1 Not assessed No segregation data were identified, so PP1 was not assessed.
PP2 N/A PP2 is a missense-specific criterion and is not applicable to this in-frame duplication.
prefetch
PP3 N/A Missense computational predictors are not applicable to this in-frame duplication. SpliceAI predicts no significant splice impact, with a maximum delta score of 0.18, but this does not provide pathogenic computational support for PP3.
spliceai
PP4 Not assessed No phenotype-specific clinical data were identified to assess whether the presentation is highly specific for a FLT3-related germline disorder, so PP4 was not assessed.
PP5 Not assessed No reputable external pathogenic classification was identified because this variant is absent from ClinVar, so PP5 was not assessed.
clinvar
BA1 Not met This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and well below the BA1 threshold of 1%. BA1 is not met.
gnomad_v2 gnomad_v4
BS1 Not met This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and below the BS1 threshold of 0.3%. BS1 is not met.
gnomad_v2 gnomad_v4
BS2 Not assessed No data were identified showing this variant in healthy adult individuals in a context sufficient for BS2, so BS2 was not assessed.
BS3 Not assessed No well-established functional study demonstrating a benign effect for this exact variant was identified, so BS3 was not assessed.
oncokb
BS4 Not assessed No nonsegregation data were identified, so BS4 was not assessed.
BP1 N/A BP1 is intended for missense variants in genes where truncating variants are the primary disease mechanism and is not applicable to this in-frame duplication.
prefetch
BP2 Not assessed No phase data with another pathogenic variant were identified, so BP2 was not assessed.
BP3 Not met This variant is an in-frame duplication in the established FLT3 juxtamembrane activating hotspot region, not a benign repeat-region event without known function. Under the local FLT3 framework, BP3 should not be applied to canonical juxtamembrane ITDs.
vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n
BP4 N/A Missense computational predictors are not applicable to this in-frame duplication. SpliceAI predicts no significant splice impact, with a maximum delta score of 0.18, but that isolated finding does not support BP4 for a protein-altering tandem duplication.
spliceai
BP5 Not assessed No alternate molecular explanation for the phenotype was identified, so BP5 was not assessed.
BP6 Not assessed No reputable external benign classification was identified because this variant is absent from ClinVar, so BP6 was not assessed.
clinvar
BP7 N/A BP7 is intended for synonymous variants with no predicted splice impact and is not applicable to this in-frame duplication.
prefetch spliceai
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.