Variant classification summary

NM_004119.2:c.1794_1795insACCATTGATTTCAGAGAATATGAA

FLT3 · NP_004110.2:p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) · NM_004119.2

GRCh37: chr13:28608261 A>ATTCATATTCTCTGAAATCAATGGT · GRCh38: chr13:28034124 A>ATTCATATTCTCTGAAATCAATGGT

Gene: FLT3 Transcript: NM_004119.2

Final call

Likely Pathogenic

PM1_Moderate PM5_Moderate PS3_Supporting PM2_Supporting

Variant details

Gene

FLT3

Transcript

NM_004119.2

Protein

NP_004110.2:p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

The FLT3 c.1794_1795insACCATTGATTTCAGAGAATATGAA (p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu); p.(E598_Y599insTIDFREYE)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

2

This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default PM2 population threshold of 0.1%.

3

This variant affects the established FLT3 juxtamembrane ITD hotspot at codons 598 to 599; published studies showed recurrent constitutive activation for FLT3 ITDs in the codon 589 to 599 cluster, and OncoKB classifies this exact variant as Likely Oncogenic with a Likely Gain-of-function effect.

4

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.06.

Final determination: PM1_Moderate and PM5_Moderate with PS3_Supporting and PM2_Supporting satisfy the Likely Pathogenic rule requiring 2 Moderate and 2 Supporting criteria.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	N/A	This in-frame insertion does not create a nonsense, frameshift, or canonical +/-1,2 splice variant, and the generic PVS1 framework therefore does not apply.	pvs1_variant_assessment pvs1_gene_context
PS1	N/A	PS1 is intended for an alternate nucleotide change causing the same previously established amino acid substitution, which is not the mechanism for this in-frame insertion.
PS2	Not assessed	No confirmed de novo data were identified, so PS2 cannot be assessed.
PS3	Met	OncoKB lists this exact FLT3 p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) variant as Likely Oncogenic with a Likely Gain-of-function effect, and published FLT3 ITD studies support constitutive activation for this mutation class. Under the local FLT3 framework, this supports PS3 at Supporting strength for an exact juxtamembrane ITD-like event.	oncokb vcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_e vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n PMID:11090077 PMID:11756186 PMID:9737679
PS4	Not assessed	No germline case-control enrichment or statistically increased prevalence in affected individuals was identified, so PS4 cannot be assessed.	clinvar cosmic
PM1	Met	This in-frame FLT3 insertion affects the juxtamembrane hotspot at codons 598 to 599, within the established codon 589 to 599 activating ITD cluster. Published data showed 47 of 51 FLT3 ITDs localized to codons 589 to 599, supporting PM1_Moderate under the local FLT3 framework.	vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n PMID:9737679
PM2	Met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default rarity threshold for PM2 (<0.1%). These population data support PM2 at Supporting strength.	gnomad_v2 gnomad_v4
PM3	Not assessed	No data were identified about occurrence with another pathogenic variant in trans, so PM3 cannot be assessed.
PM4	N/A	Although this is an in-frame length change, the local FLT3 framework advises not to apply PM4 separately for canonical juxtamembrane ITD or activating length-mutation events because the hotspot and mechanism are already captured by PM1 and custom PM5.	vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n
PM5	Met	This novel in-frame FLT3 juxtamembrane insertion falls in the established activating ITD hotspot class at codons 598 to 599, where recurrent pathogenic or oncogenic FLT3 ITDs and activating length mutations are already established. Under the local FLT3 framework, this supports custom PM5_Moderate for a novel activating length-mutation analogue in the same hotspot mechanism class.	vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n vcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_e clinvar PMID:9737679 PMID:12384447
PM6	Not assessed	No assumed de novo occurrence without confirmed parental testing was identified, so PM6 cannot be assessed.
PP1	Not assessed	No segregation data were identified, so PP1 cannot be assessed.
PP2	N/A	PP2 is intended for selected missense contexts and is not applicable to this in-frame insertion.
PP3	N/A	No validated in silico framework was identified for applying PP3 to this in-frame insertion. SpliceAI shows a low predicted splice effect with a maximum delta score of 0.06, which does not provide splice-based pathogenic computational support.	spliceai
PP4	Not assessed	No phenotype information was provided to determine whether the clinical presentation is highly specific for a FLT3-related disorder, so PP4 cannot be assessed.
PP5	Not assessed	No reputable external germline classification was identified, and PP5 is not used here.	clinvar
BA1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is well below the benign stand-alone threshold of 1% and BA1 is not met.	gnomad_v2 gnomad_v4
BS1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is below the benign strong threshold of 0.3% and BS1 is not met.	gnomad_v2 gnomad_v4
BS2	Not assessed	No evidence was identified that this variant is observed in healthy adult individuals at a frequency inconsistent with disease, so BS2 cannot be assessed.
BS3	Not met	Available functional evidence does not show a normal or benign effect. Instead, OncoKB and the FLT3 ITD literature support an activating effect, so BS3 is not met.	oncokb PMID:11090077 PMID:11756186 PMID:9737679
BS4	Not assessed	No segregation data showing lack of cosegregation with disease were identified, so BS4 cannot be assessed.
BP1	N/A	BP1 is intended for missense variants in genes where truncating variants are the primary disease mechanism and is not applicable to this in-frame insertion.
BP2	Not assessed	No phase information with another variant was identified, so BP2 cannot be assessed.
BP3	Not met	This in-frame insertion is located in the established FLT3 juxtamembrane activating hotspot, so the benign repetitive-region criterion BP3 should not be applied.	vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n
BP4	Not met	SpliceAI predicts no significant splice impact with a maximum delta score of 0.06, but that only argues against a splice-mediated mechanism and does not support a benign overall effect for this activating in-frame hotspot insertion. BP4 is therefore not met.	spliceai
BP5	Not assessed	No alternate molecular diagnosis was identified that would explain the phenotype independently of this variant, so BP5 cannot be assessed.
BP6	Not assessed	No reputable external benign classification was identified, and BP6 is not used here.	clinvar
BP7	N/A	BP7 applies to synonymous or certain noncoding variants with no predicted splice effect and is not applicable to this in-frame insertion.	spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.