Variant classification summary

NM_000059.4:c.29_63del

BRCA2 · NP_000050.3:p.(Thr10SerfsTer9) · NM_000059.4

GRCh37: chr13:32890623 CAACATTTTTTGAAATTTTTAAGACACGCTGCAACA>C · GRCh38: chr13:32316486 CAACATTTTTTGAAATTTTTAAGACACGCTGCAACA>C

Gene: BRCA2 Transcript: NM_000059.4

Final call

Pathogenic

Variant details

Gene

BRCA2

Transcript

NM_000059.4

Protein

NP_000050.3:p.(Thr10SerfsTer9)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

The BRCA2 c.29_63del (p.(Thr10SerfsTer9)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar; OncoKB classifies p.(T10Sfs*9) as Likely Oncogenic with a likely loss-of-function effect.

2

This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 in the queried population datasets.

3

The deletion causes an early frameshift with premature termination in exon 2, and ENIGMA BRCA2 Table 4 assigns exon 2 protein-truncating variants PVS1 and PM5_Strong (PTC), which supports a loss-of-function disease mechanism for this variant.

4

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.04.

Final determination: Pathogenic based on 1 very strong and 1 strong pathogenic criterion (PVS1 and PM5).

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	This variant is a 35 bp deletion in BRCA2 exon 2 that causes a frameshift and premature termination, p.(Thr10SerfsTer9). Loss of function is an established disease mechanism for BRCA2, and ENIGMA BRCA2 Table 4 assigns exon 2 protein-truncating variants PVS1; this supports PVS1 at very strong strength.	cspec pvs1_gene_context pvs1_variant_assessment vcep_s_p_e_c_i_f_i_c_a_t_i_o_n_s___t_a_b_l_e_4___v_1___2___2_0_2_4___1_1___1_8
PS1	Not assessed	No evidence was identified showing that this variant produces the same amino acid change or the same predicted splice effect as a previously classified pathogenic or likely pathogenic BRCA2 variant.	cspec
PS2	N/A	De novo evidence is not used for BRCA2 in the applied ENIGMA specification, so this criterion is not applicable.	cspec
PS3	Not assessed	No variant-specific calibrated functional study result was identified for NM_000059.4:c.29_63del in the curated ENIGMA functional table, so PS3 cannot be applied from the available evidence.	cspec vcep_s_p_e_c_i_f_i_c_a_t_i_o_n_s___t_a_b_l_e_9___v_1___2___2_0_2_4___1_1___1_8
PS4	Not assessed	No case-control study or quantitative enrichment data were identified showing that this variant is significantly more frequent in affected individuals than in controls, so PS4 is not established.	cspec clinvar vcep_s_u_p_p_l_e_m_e_n_t_a_r_y_t_a_b_l_e_s___v_1___2___2_0_2_4___1_1___1_8
PM1	N/A	PM1 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
PM2	Not assessed	This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed allele frequency of 0 in the queried datasets. However, the ENIGMA PM2 rule specifies absence in gnomAD v2.1 and v3.1 with adequate read depth, and the required v3.1 and coverage confirmation were not identified here, so PM2 was not adjudicated as met.	cspec gnomad_v2 gnomad_v4
PM3	Not assessed	No evidence was identified that this variant was observed in trans with another BRCA2 variant in an individual with BRCA2-related Fanconi anemia, so PM3 is not established.	cspec
PM4	N/A	PM4 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
PM5	Met	This variant creates a premature termination codon in BRCA2 exon 2. ENIGMA BRCA2 Table 4 assigns PM5_Strong (PTC) to exon 2 protein-truncating variants when PVS1 is applicable, so this criterion is met at strong strength.	cspec vcep_s_p_e_c_i_f_i_c_a_t_i_o_n_s___t_a_b_l_e_4___v_1___2___2_0_2_4___1_1___1_8
PM6	N/A	Assumed de novo evidence is not used for BRCA2 in the applied ENIGMA specification, so this criterion is not applicable.	cspec
PP1	Not assessed	No segregation data were identified for this variant, so co-segregation evidence supporting pathogenicity was not established.	cspec
PP2	N/A	PP2 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
PP3	N/A	PP3 in the BRCA2 ENIGMA specification is used for missense, in-frame, silent, or relevant intronic variants with predicted splice or protein impact. This variant is a frameshift deletion, so PP3 is not applicable.	cspec spliceai
PP4	Not assessed	No multifactorial likelihood analysis or other quantitative phenotype-specific evidence was identified for this variant, so PP4 was not established.	cspec vcep_s_u_p_p_l_e_m_e_n_t_a_r_y_t_a_b_l_e_s___v_1___2___2_0_2_4___1_1___1_8 vcep_h_u_m_u___4_0___1_5_5_7___s_0_0_1
PP5	N/A	PP5 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
BA1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 and is below the ENIGMA BA1 threshold of greater than 0.1% (FAF > 0.001). BA1 is not met.	cspec gnomad_v2 gnomad_v4
BS1	Not met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0 and is below the ENIGMA BS1 thresholds of greater than 0.01% for BS1 or greater than 0.002% for BS1_Supporting. BS1 is not met.	cspec gnomad_v2 gnomad_v4
BS2	Not assessed	No evidence was identified showing this variant in individuals lacking features of BRCA2-related Fanconi anemia under the ENIGMA BS2 framework, so BS2 was not established.	cspec
BS3	Not assessed	No variant-specific calibrated functional study showing no damaging effect was identified for NM_000059.4:c.29_63del, so BS3 cannot be applied from the available evidence.	cspec vcep_s_p_e_c_i_f_i_c_a_t_i_o_n_s___t_a_b_l_e_9___v_1___2___2_0_2_4___1_1___1_8
BS4	Not assessed	No lack-of-segregation data were identified for this variant, so BS4 was not established.	cspec vcep_s_u_p_p_l_e_m_e_n_t_a_r_y_t_a_b_l_e_s___v_1___2___2_0_2_4___1_1___1_8 vcep_h_u_m_u___4_0___1_5_5_7___s_0_0_1
BP1	N/A	BP1 in the BRCA2 ENIGMA specification applies to silent, missense, or in-frame variants outside clinically important domains without predicted splice impact. This variant is a frameshift deletion, so BP1 is not applicable.	cspec spliceai
BP2	N/A	BP2 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
BP3	N/A	BP3 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
BP4	N/A	BP4 in the BRCA2 ENIGMA specification applies to selected missense, in-frame, silent, or intronic variants with no predicted impact. This variant is a frameshift deletion, so BP4 is not applicable.	cspec spliceai
BP5	Not assessed	No multifactorial likelihood evidence arguing against pathogenicity was identified for this variant, so BP5 was not established.	cspec
BP6	N/A	BP6 is not applicable in the BRCA2 ENIGMA specification for this interpretation framework.	cspec
BP7	N/A	BP7 in the BRCA2 ENIGMA specification applies to silent, intronic, or selected RNA-tested variants without damaging splice effect. This variant is a frameshift deletion, so BP7 is not applicable.	cspec spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.