NM_001202544.1:c.1657_1716+4dup

CUX1 · NP_001189473.1:p.? · NM_001202544.1

GRCh37: chr7:101923352 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC · GRCh38: chr7:102280060 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC

Gene: CUX1 Transcript: NM_001202544.1

Final call

VUS

PM2 supporting

Variant details

Gene

CUX1

Transcript

NM_001202544.1

Protein

NP_001189473.1:p.?

gnomAD AF

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

The CUX1 c.1657_1716+4dup (NP_001189473.1:p.?) variant has not been reported in ClinVar.

This variant is absent from gnomAD v2.1 and gnomAD v4.1, which supports rarity in population databases.

Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories based on the available variant-level assessment.

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.05.

Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not met	Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants, so PVS1 is not applied.	pvs1_gene_context pvs1_variant_assessment pvs1_generic_framework
PS1	Not assessed	No evidence was identified showing that this variant results in the same amino acid change as a previously established pathogenic variant.
PS2	Not assessed	No confirmed de novo occurrence data were identified for this variant.	clinvar
PS3	Not assessed	No well-established functional studies were identified for this variant.	clinvar
PS4	Not assessed	No evidence was identified showing that this variant is enriched in affected individuals compared with controls.	clinvar gnomad_v2 gnomad_v4
PM1	Not assessed	Available evidence does not establish that this variant lies in a mutational hotspot or a well-studied critical region without benign variation.
PM2	Met	This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the generic rarity threshold of 0.1% for PM2 support and is consistent with a rare variant.	gnomad_v2 gnomad_v4
PM3	Not assessed	No data were identified showing this variant in trans with another pathogenic variant.	clinvar
PM4	Not assessed	This duplication extends from coding sequence into intronic sequence, and the resulting protein consequence remains uncertain, so protein-length change evidence cannot be applied from the available data.	pvs1_variant_assessment
PM5	Not assessed	No evidence was identified for a different pathogenic missense change at the same residue because the protein consequence of this variant is unresolved.
PM6	Not assessed	No presumed de novo occurrence data were identified for this variant.	clinvar
PP1	Not assessed	No segregation data were identified for this variant.	clinvar
PP2	N/A	PP2 is a missense-specific criterion, and this variant is not an established missense change.
PP3	Not met	Available computational evidence does not support a damaging splicing effect because SpliceAI shows a maximum delta score of 0.05, which is below commonly used splice-impact thresholds; REVEL and BayesDel were not available because this is not an SNV.	spliceai
PP4	Not assessed	No phenotype information was provided to determine whether the observed clinical features are highly specific for a CUX1-related disorder.
PP5	Not assessed	No reputable source classification was identified for this variant.	clinvar
BA1	Not met	This variant is absent from gnomAD v2.1 and v4.1 and therefore does not meet the stand-alone benign frequency threshold of 1%.	gnomad_v2 gnomad_v4
BS1	Not met	This variant is absent from gnomAD v2.1 and v4.1 and therefore does not exceed the benign frequency threshold of 0.3%.	gnomad_v2 gnomad_v4
BS2	Not assessed	No evidence was identified showing this variant in healthy adults for a disorder with expected penetrance at the relevant age.	gnomad_v2 gnomad_v4
BS3	Not assessed	No well-established functional studies were identified showing no damaging effect for this variant.	clinvar
BS4	Not assessed	No non-segregation data were identified for this variant.	clinvar
BP1	N/A	BP1 is a missense-specific criterion, and this variant is not an established missense change.
BP2	Not assessed	No phasing data were identified to determine whether this variant occurs in trans with a pathogenic variant for a dominant disorder or in cis with another pathogenic variant.	clinvar
BP3	Not assessed	Available evidence does not show that this duplication is an in-frame event in a repetitive region without known function.
BP4	Not assessed	SpliceAI predicts no significant splice impact with a maximum delta score of 0.05, but this exon-intron duplication also alters coding sequence and the overall transcript and protein consequence remains uncertain, so benign computational evidence is not applied.	spliceai
BP5	Not assessed	No alternate molecular explanation for disease was provided, so this criterion cannot be assessed from the available evidence.
BP6	Not assessed	No reputable source reported this variant as benign or likely benign.	clinvar
BP7	N/A	BP7 applies to synonymous or intronic variants without predicted splice impact, and this variant is a duplication that includes coding sequence.	spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.