NM_021946.4:c.643_798dup

BCORL1 · NP_068765.3:p.(His215_Pro266dup) · NM_021946.4

GRCh37: chrX:129147384 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA · GRCh38: chrX:130013408 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA

Gene: BCORL1 Transcript: NM_021946.4

Final call

VUS

PM2 supporting

Variant details

Gene

BCORL1

Transcript

NM_021946.4

Protein

NP_068765.3:p.(His215_Pro266dup)

gnomAD AF

ClinVar

OncoKB

Unknown Oncogenic Effect

Classification rationale

Interpretation summary

Generated evidence synthesis

The BCORL1 c.643_798dup (p.His215_Pro266dup) variant has not been observed in somatic cancer records in COSMIC and has not been reported in ClinVar.

This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, with an observed population frequency of 0, which is below the 0.1% rarity threshold used for PM2.

In silico splice prediction does not support an abnormal splicing effect, with a SpliceAI maximum delta score of 0.00.

Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not met	BCORL1 loss of function appears to be an established germline disease mechanism, but this variant is an in-frame duplication rather than a nonsense, frameshift, or canonical splice-site variant. Under the generic PVS1 framework, available evidence does not support applying PVS1 to this variant.	pvs1_gene_context pvs1_variant_assessment pvs1_generic_framework
PS1	Not assessed	PS1 is intended for the same amino acid change as a previously established pathogenic variant. No such comparison variant was identified.	clinvar
PS2	Not assessed	No de novo data were identified for this variant. Available evidence does not support confirmed maternity and paternity with a de novo occurrence.
PS3	Not assessed	No well-established functional study of this specific variant was identified. Available evidence does not show a damaging effect in a validated assay.	oncokb
PS4	Not met	This variant has not been reported in ClinVar or COSMIC, and no case series or enrichment data in affected individuals were identified. Available evidence does not support increased prevalence in affected individuals over controls.	clinvar gnomad_v2 gnomad_v4
PM1	Not met	This variant does not lie in a statistically significant hotspot, and no critical functional domain with established pathogenic clustering at this interval was identified. Available evidence does not support PM1.	hotspots oncokb
PM2	Met	This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1. Its observed population frequency is therefore 0, which is below the non-VCEP PM2 threshold of 0.1%, supporting rarity.	gnomad_v2 gnomad_v4
PM3	Not assessed	No phase data or additional pathogenic variant data were identified. Available evidence does not support evaluation under PM3.
PM4	Not assessed	This variant is an in-frame protein duplication, but available evidence does not establish that this protein length change occurs in a clearly non-repetitive, functionally constrained region or has a demonstrated pathogenic effect. Additional variant-specific or domain-specific evidence would be needed to apply PM4.	oncokb
PM5	N/A	PM5 is intended for a novel missense change at an amino acid residue where a different pathogenic missense change is established. This variant is an in-frame duplication, so PM5 is not applicable.
PM6	Not assessed	No assumed de novo occurrence was identified for this variant. Available evidence does not support PM6.
PP1	Not assessed	No segregation data were identified for this variant. Available evidence does not support co-segregation with disease in multiple affected family members.
PP2	N/A	PP2 is a missense criterion. This variant is an in-frame duplication, so PP2 is not applicable.
PP3	Not met	SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00. REVEL and BayesDel were not available because this is not a single-nucleotide variant, and available computational evidence does not support a damaging prediction.	spliceai
PP4	Not assessed	No phenotype information was provided to assess whether the clinical presentation is highly specific for a BCORL1-related disorder. Available evidence does not support PP4.
PP5	Not assessed	No reputable source classification for this specific variant was identified. Available evidence does not support PP5.	clinvar
BA1	Not met	This variant is absent from gnomAD v2.1 and v4.1. Its observed population frequency is 0, which is below the BA1 threshold of 1%, so BA1 is not met.	gnomad_v2 gnomad_v4
BS1	Not met	This variant is absent from gnomAD v2.1 and v4.1. Its observed population frequency is 0, which is below the BS1 threshold of 0.3%, so BS1 is not met.	gnomad_v2 gnomad_v4
BS2	Not assessed	No evidence was identified showing this variant in healthy adults for a disorder with expected full penetrance at an early age. Available evidence does not support BS2.
BS3	Not assessed	No well-established functional study showing normal function for this specific variant was identified. Available evidence does not support BS3.	oncokb
BS4	Not assessed	No non-segregation data were identified for this variant. Available evidence does not support BS4.
BP1	N/A	BP1 is intended for missense variants in genes where truncating variants are the main known mechanism. This variant is an in-frame duplication, so BP1 is not applicable.
BP2	Not assessed	No phase information or additional variant data were identified to assess BP2. Available evidence does not support this criterion.
BP3	Not assessed	This variant is an in-frame duplication, but available evidence does not adequately establish that it lies within a benign repetitive region without known function. Additional protein-region evidence would be needed to apply BP3 confidently.
BP4	Not met	SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00, but this alone does not establish a benign protein effect for an in-frame duplication. REVEL and BayesDel were not available because this is not a single-nucleotide variant, so available computational evidence is insufficient to support BP4.	spliceai
BP5	Not assessed	No alternate molecular diagnosis or alternate established cause for the phenotype was identified. Available evidence does not support BP5.
BP6	Not assessed	No reputable source benign classification for this specific variant was identified. Available evidence does not support BP6.	clinvar
BP7	N/A	BP7 is intended for synonymous or certain noncoding variants with no predicted splice impact. This variant is an in-frame coding duplication, so BP7 is not applicable.	spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.