Variant classification summary

NM_000314.8:c.101_126del

PTEN · NP_000305.3:p.(Ala34GlyfsTer9) · NM_000314.8

GRCh37: chr10:89653802 GCTATGGGATTTCCTGCAGAAAGACTT>G · GRCh38: chr10:87894045 GCTATGGGATTTCCTGCAGAAAGACTT>G

Gene: PTEN Transcript: NM_000314.8

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.(Ala34GlyfsTer9)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

The PTEN c.101_126del (p.Ala34GlyfsTer9; p.A34Gfs*9) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

2

This variant is absent from gnomAD v2.1 and gnomAD v4.1, placing it below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%) and supporting PM2 at the supporting level.

3

No direct functional study of this exact deletion was identified, and the PTEN phosphatase activity assay resource curated by the Expert Panel applies to missense variants rather than this frameshift variant.

4

This deletion causes an early frameshift predicted to produce p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]; under the PTEN PVS1 decision tree, a truncating variant 5' to p.D375 in NM_000314.8 supports PVS1, and SpliceAI also predicts possible splice impact with a maximum delta score of 0.51.

Final determination: Rule20 in the Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework is satisfied by the adjudicated criteria, so the variant is classified as Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	This variant is an early frameshift deletion in PTEN, NM_000314.8:c.101_126del, predicted to cause p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]. Under the PTEN-specific PVS1 decision tree, a frameshift at or 5' to p.D375 in the biologically relevant transcript NM_000314.8 is assigned PVS1, and this predicted truncation is far upstream of that threshold and expected to undergo nonsense-mediated decay.	cspec vcep_pvs1_decisiontree_pten pvs1_gene_context pvs1_variant_assessment
PS1	N/A	This criterion is not applicable because PS1 is for a different nucleotide change producing the same amino acid substitution, and this variant is a frameshift deletion rather than a shared missense or equivalent splicing event.	cspec
PS2	Not assessed	No confirmed de novo observation was identified for this variant. Available evidence does not document maternity and paternity confirmation in an affected individual with no family history.	clinvar
PS3	Not assessed	No direct functional study of this exact deletion was identified that would support a damaging effect at the PS3 evidence level. The PTEN VCEP phosphatase assay resource is specified for missense variants, and no RNA or other functional assay result for this frameshift deletion was identified.	cspec vcep_mmc2 oncokb PMID:11237521 PMID:17218262
PS4	Not assessed	No case series, enrichment study, or count of unrelated affected individuals carrying this variant was identified. The available evidence is insufficient to show that this variant is more prevalent in affected individuals than in controls.	clinvar gnomad_v2 gnomad_v4
PM1	Not met	This variant does not meet PM1 because it affects codon 34, which is outside the PTEN catalytic motif residues defined by the PTEN Expert Panel (90-94, 123-130, and 166-168). No hotspot evidence supporting this residue as a critical mutational hotspot was identified.	cspec hotspots
PM2	Met	This variant is absent from gnomAD v2.1 and gnomAD v4.1. This population frequency is below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%), supporting PM2 at the supporting level.	cspec gnomad_v2 gnomad_v4
PM3	N/A	This criterion is not applicable in the PTEN Expert Panel framework.	cspec
PM4	N/A	This criterion is not applicable because PM4 is used for in-frame insertions or deletions and stop-loss variants, whereas this variant is a frameshift deletion already evaluated under PVS1.	cspec
PM5	N/A	This criterion is not applicable because PM5 is for a novel missense change at an amino acid residue where a different pathogenic missense change has been established, and this variant is a frameshift deletion.	cspec
PM6	Not assessed	No presumed de novo observation was identified for this variant. Available evidence does not show this variant arising de novo in an affected individual without confirmed parentage.	clinvar
PP1	Not assessed	No segregation data were identified for this variant. Available evidence does not document co-segregation with PTEN-related disease across informative meioses.	clinvar
PP2	N/A	This criterion is not applicable because PP2 is a missense-based rule, and this variant is a frameshift deletion.	cspec
PP3	Not assessed	SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above a benign range, but the PTEN Expert Panel requires concordant splicing predictors for splicing-based PP3/BP4 use. No concordant second splicing predictor result was identified, and the missense-based REVEL rule does not apply to this deletion.	cspec spliceai
PP4	N/A	This criterion is not applicable in the PTEN Expert Panel framework because phenotype specificity is incorporated into PS4 usage.	cspec
PP5	N/A	This criterion is not applicable in the PTEN Expert Panel framework.	cspec
BA1	Not met	This variant does not meet BA1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BA1 threshold of >0.00056 (0.056%).	cspec gnomad_v2 gnomad_v4
BS1	Not met	This variant does not meet BS1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BS1 supporting range of 0.0000043-0.000043 and strong range of 0.000043-0.00056.	cspec gnomad_v2 gnomad_v4
BS2	Not assessed	No evidence was identified that this variant has been observed in the homozygous state in a healthy or PTEN hamartoma tumor syndrome-unaffected individual.	clinvar gnomad_v2 gnomad_v4
BS3	Not assessed	No direct functional study of this exact deletion was identified showing no damaging effect. The PTEN VCEP phosphatase assay resource is specified for missense variants, and no RNA assay showing normal splicing for this deletion was identified.	cspec vcep_mmc2
BS4	Not assessed	No lack-of-segregation evidence was identified for this variant. Available evidence does not document clinically affected relatives who do not carry the variant or unaffected carriers in a way that would satisfy BS4.	clinvar
BP1	N/A	This criterion is not applicable in the PTEN Expert Panel framework.	cspec
BP2	Not assessed	No phase data were identified showing this variant in trans with a pathogenic PTEN variant or repeated cis/phase-unknown observations with different pathogenic PTEN variants.	clinvar
BP3	N/A	This criterion is not applicable in the PTEN Expert Panel framework.	cspec
BP4	Not met	This variant does not meet BP4. SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above the PTEN benign splicing range of 0-0.2, and no concordant benign splicing prediction was identified. The REVEL-based BP4 missense rule is not applicable to this deletion.	cspec spliceai
BP5	Not assessed	No evidence was identified that this variant was found in an individual with an alternate highly penetrant molecular explanation for the phenotype and no overlap with PTEN-related disease.	clinvar
BP6	N/A	This criterion is not applicable in the PTEN Expert Panel framework.	cspec
BP7	N/A	This criterion is not applicable because BP7 is for synonymous or qualifying intronic variants, and this variant is an exonic frameshift deletion.	cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.