LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-05-27
Case ID: NM_004119.2_c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT_20260527_195255
Framework: ACMG/AMP 2015 with custom FLT3 criterion specifications
Variant classification summary

NM_004119.2:c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT

FLT3  · NP_004110.2:p.(Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu)  · NM_004119.2
GRCh37: chr13:28608220 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC  ·  GRCh38: chr13:28034083 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC
Gene: FLT3 Transcript: NM_004119.2
Final call
Likely Pathogenic
PS3_supporting PM1_moderate PM2_supporting PM5_moderate
All criteria require review: For research and educational purposes only.
Variant details
Gene
FLT3
Transcript
NM_004119.2
Protein
NP_004110.2:p.(Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
The FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT (p.(E611_F612insLAWEFPRENLE)) variant has not been reported in ClinVar.
2
This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0.
3
Mutalyzer normalization is consistent with an FLT3 internal tandem duplication, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects; the exact p.(E611_F612insLAWEFPRENLE) event also has variant-specific curated evidence consistent with likely gain of function.
4
SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.09.
Final determination: Under the local FLT3 ITD / activating length-mutation framework, the combination of 2 Moderate and 2 Supporting pathogenic criteria supports a Likely Pathogenic classification.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 N/A This variant is an in-frame insertion and does not fall into the generic PVS1 null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants, so PVS1 is not applicable.
pvs1_gene_context pvs1_variant_assessment pvs1_generic_framework
PS1 N/A PS1 is intended for a variant that results in the same amino acid change as a previously established pathogenic variant. This in-frame insertion does not fit that rule.
PS2 Not assessed No confirmed de novo data were identified, so PS2 cannot be assessed.
PS3 Met The exact FLT3 p.(E611_F612insLAWEFPRENLE) event has a variant-specific curated OncoKB entry with Likely Gain-of-function and Likely Oncogenic annotations, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects consistent with this established activating mechanism. In the local FLT3 framework, this supports PS3 at Supporting strength.
oncokb PMID:11090077 PMID:11756186 PMID:12384447 PMID:9737679 vcep_flt3_itd_hotspot_and_function vcep_flt3_oncokb_guidance
PS4 Not assessed No case-control or enrichment data comparing affected and unaffected individuals were identified, so PS4 was not assessed.
PM1 Met Mutalyzer normalized this variant to NM_004119.2:c.1835_1836ins[GGCT;1807_1835], indicating duplication of a nearby reference interval consistent with an FLT3 internal tandem duplication. The protein consequence p.(E611_F612insLAWEFPRENLE) lies in the juxtamembrane region, and published FLT3 ITD data showed that the classic activating hotspot is centered in codons 589-599. In the local FLT3 framework, a juxtamembrane ITD/activating length-mutation event in this established hotspot mechanism meets PM1_Moderate.
PMID:9737679 PMID:11090077 PMID:11756186 vcep_flt3_itd_hotspot_and_function
PM2 Met This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so its observed population frequency is 0 and remains below the usual PM2 rarity threshold of 0.1%. This supports PM2 at Supporting strength.
gnomad_v2 gnomad_v4 gnomad_canada
PM3 N/A PM3 is used for recessive disorders with trans observations. No relevant recessive disease context or trans data were identified for this variant.
PM4 N/A Although this is a protein-length change, the local FLT3 framework states that PM4 should not be applied separately for canonical juxtamembrane FLT3 internal tandem duplication or activating length-mutation events when PM1 and/or the custom PM5 rule already capture the hotspot and established activating mechanism.
vcep_flt3_itd_hotspot_and_function
PM5 Met The local FLT3 framework uses a custom PM5 rule for novel in-frame internal tandem duplications and activating length mutations in the established juxtamembrane hotspot class rather than classic same-residue missense logic. This variant is an in-frame juxtamembrane ITD-class event, and published FLT3 literature has already established pathogenic/oncogenic activating length mutations in this hotspot mechanism. This supports PM5_Moderate under the local FLT3 framework.
pm5_candidates PMID:9737679 PMID:12384447 vcep_flt3_itd_hotspot_and_function vcep_flt3_oncokb_guidance
PM6 Not assessed No assumed de novo data without confirmed parentage were identified, so PM6 was not assessed.
PP1 Not assessed No segregation data were identified, so PP1 cannot be assessed.
PP2 N/A PP2 is a missense-specific criterion and is not applicable to this in-frame insertion.
PP3 Not met Computational evidence does not support a damaging splicing effect. SpliceAI showed a maximum delta score of 0.09, which is below commonly used splice-impact concern thresholds, and REVEL, BayesDel, and HCI prior scores are not applicable or not available for this non-SNV in-frame insertion. Therefore, PP3 is not met.
spliceai
PP4 Not assessed No specific germline phenotype or family-level clinical presentation was provided that would allow PP4 assessment.
PP5 N/A PP5 was not used. No ClinVar submission was identified for this variant, and reputable-source-only criteria are not relied on here.
clinvar
BA1 Not met This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not meet the BA1 stand-alone benign frequency threshold of greater than 1%.
gnomad_v2 gnomad_v4 gnomad_canada
BS1 Not met This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not exceed the BS1 benign frequency threshold of greater than 0.3%.
gnomad_v2 gnomad_v4 gnomad_canada
BS2 Not assessed No evidence was identified showing this variant in a sufficient number of healthy adults for BS2 assessment.
BS3 Not met Available functional evidence does not show a benign or normal effect. Published FLT3 internal tandem duplication studies support an activating mechanism rather than a benign one, so BS3 is not met.
PMID:11090077 PMID:11756186 PMID:12384447 PMID:9737679 vcep_flt3_itd_hotspot_and_function
BS4 Not assessed No segregation data showing lack of cosegregation with disease were identified, so BS4 was not assessed.
BP1 N/A BP1 is a missense-specific criterion and is not applicable to this in-frame insertion.
BP2 Not assessed No phase data with another pathogenic variant were identified, so BP2 was not assessed.
BP3 Not met BP3 should not be applied to FLT3 juxtamembrane internal tandem duplication or activating length-mutation events because this region has a known activating disease mechanism and recurrent pathogenic/oncogenic variation.
vcep_flt3_itd_hotspot_and_function
BP4 Not met SpliceAI predicts no significant splice impact for this variant with a maximum delta score of 0.09, but this does not provide benign support for an in-frame juxtamembrane FLT3 insertion with an established activating protein-level mechanism. Therefore, BP4 is not met.
spliceai
BP5 Not assessed No alternate molecular explanation for a reported phenotype was identified, so BP5 was not assessed.
BP6 N/A BP6 was not used. No ClinVar submission was identified for this variant, and reputable-source-only benign criteria are not relied on here.
clinvar
BP7 N/A BP7 is intended for synonymous or certain intronic variants without splice impact and is not applicable to this in-frame coding insertion.
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.