Variant classification summary

NM_003016.4:c.284_307delCCCCCGGACTCACACCACAGCCGC

· ·

GRCh37: None · GRCh38: None

Gene: Transcript:

Final call

VUS

PM4 moderate

Variant details

Gene

Transcript

Protein

gnomAD AF

ClinVar

None

OncoKB

None

Classification rationale

Interpretation summary

Generated evidence synthesis

1

NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides in SRSF2, resulting in loss of 8 amino acids (p.Pro95_Arg102del) at the boundary of the RRM and RS-rich domains.

2

The deletion meets PM4 (moderate) because it causes a protein length change through an in-frame deletion in a non-repetitive region, per ACMG/AMP 2015 guidelines.

3

BP3 is not met because the deleted region is non-repetitive and includes Pro95, a residue of established functional significance in SRSF2.

4

PVS1 is not applicable: the variant is an in-frame deletion rather than a null variant. Per ClinGen SVI PVS1 recommendations, in-frame deletions are not eligible for PVS1 at any strength level.

5

Population frequency data from gnomAD v2.1 and v4.1 are unavailable due to incomplete variant normalization in the pipeline. gnomAD-Canada reports AC=0, AN=0 (no data), precluding application of PM2, BA1, or BS1.

6

Pro95 is a known somatic mutational hotspot in SRSF2 (ClinVar: P95H Pathogenic, P95L Pathogenic, P95R Likely pathogenic), but germline hotspot evidence for SRSF2 is not established, so PM1 is not met in this context.

7

Multiple criteria (PS2, PS3, PS4, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5, BP6) remain not_assessed due to absence of case-level, functional, segregation, or population data in the available evidence.

8

Based on available evidence, the only applicable criterion is PM4 (moderate). The evidence is insufficient to reach a definitive classification; the variant defaults to Variant of Uncertain Significance (VUS) under generic ACMG/AMP 2015 combination rules.

Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	N/A	PVS1 is reserved for null variants (nonsense, frameshift, canonical splice, initiation codon, single/multi-exon deletions). NM_003016.4:c.284_307del is an in-frame deletion of 24 bp resulting in p.(Pro95_Arg102del), which does not trigger nonsense-mediated decay or abolish gene function through a null mechanism. Per ClinGen SVI PVS1 recommendations (PMC6185798), in-frame deletions are not eligible for PVS1 at any strength.	pvs1_generic_framework
PS1	N/A	PS1 applies when a variant produces the same amino acid change as a previously established pathogenic missense variant. This variant is an in-frame deletion of 8 amino acids, not a single amino acid substitution.
PS2	Not assessed	No de novo occurrence data available for this variant. PS2 requires confirmed de novo observation in a patient with disease and no family history.
PS3	Not assessed	No functional studies evaluating this specific in-frame deletion were identified in the case evidence.
PS4	Not assessed	No case-control or cohort data comparing variant prevalence in affected versus unaffected individuals were identified.
PS5	N/A	PS5 is not a standard ACMG/AMP 2015 criterion. It is used only in certain VCEP/CSPEC frameworks; this case uses generic ACMG/AMP rules.
PM1	Not met	The deletion removes Pro95, a residue that is a well-known somatic mutational hotspot in SRSF2 for myeloid malignancies (P95H, P95L, P95R are classified as Pathogenic/Likely pathogenic in ClinVar). However, PM1 in the germline ACMG/AMP framework requires evidence that the variant lies within a recognized germline mutational hotspot or critical functional domain established for the associated disease. The Cancer Hotspots database did not flag this exact variant, and no germline-specific hotspot evidence was retrieved.	generic_acmg_combination_rules
PM2	Not assessed	gnomAD v2.1 and v4.1 population frequency data are not available (null values in evidence_brief). gnomAD-Canada reports AC=0, AN=0, indicating absence of data rather than confirmed absence from population. PM2 cannot be applied without valid population allele frequency data.
PM4	Met	NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides, resulting in loss of 8 amino acids (Pro95 through Arg102) without disruption of the reading frame. The deletion spans a non-repetitive region at the boundary of the RRM domain and the RS-rich domain. Per ACMG/AMP 2015 (PMID:25741868), in-frame deletions in non-repeat regions meet PM4 at moderate strength.	generic_acmg_combination_rules
PM5	N/A	PM5 applies to a novel missense variant occurring at the same amino acid residue as a previously established pathogenic missense change. This variant is an in-frame deletion, not a missense substitution.
PM6	Not assessed	No de novo occurrence data available. PM6 requires a de novo observation without confirmed maternity/paternity.
PP1	Not assessed	No co-segregation data available for this variant.
PP2	N/A	PP2 applies to missense variants in genes where missense variants are a common disease mechanism and benign missense variation is rare. This variant is an in-frame deletion, not a missense substitution.
PP3	N/A	PP3 relies on in silico missense prediction tools (REVEL, BayesDel, etc.) and/or SpliceAI scores. These tools are designed for single-nucleotide missense variants or splice-site variants and are not validated for in-frame deletions. No SpliceAI delta score is available for this variant.
PP4	Not assessed	No patient phenotype or family history information was provided for this case.
PP5	Not met	PP5 requires that a reputable source (e.g., clinical diagnostic laboratory) has reported the variant as pathogenic. No ClinVar entry was found for this variant, and no other reputable source reporting was identified.
BA1	Not assessed	BA1 requires an allele frequency >1% in a general population database. gnomAD v2.1 and v4.1 data are unavailable (null). Cannot assess BA1 without population frequency data.
BS1	Not assessed	BS1 requires an allele frequency >0.3% in a general population database. gnomAD v2.1 and v4.1 data are unavailable. Cannot assess BS1 without population frequency data.
BS2	Not assessed	No data on observation in healthy adults (homozygous state or in trans with a pathogenic variant) was identified.
BS3	Not assessed	No well-established functional studies showing no damaging effect for this specific variant were identified.
BS4	Not assessed	No segregation data in affected families is available to evaluate lack of segregation.
BP1	N/A	BP1 applies to missense variants in genes where the primary disease mechanism is truncating/loss-of-function. This variant is an in-frame deletion, not a missense substitution.
BP2	Not assessed	No data on observation in trans with a known pathogenic variant was identified.
BP3	Not met	BP3 applies to in-frame deletions in repetitive regions without known function. The deletion removes residues Pro95 through Arg102 in SRSF2. This region is not repetitive, and Pro95 is a well-established functional residue (somatic hotspot in myeloid malignancies). The RRM/RS-domain boundary region has known functional significance.	generic_acmg_combination_rules
BP4	N/A	BP4 relies on multiple lines of computational evidence (REVEL, BayesDel, SpliceAI, etc.) suggesting no impact. These tools are designed for missense or splice-site variants and are not validated for in-frame deletions.
BP5	Not assessed	BP5 requires observation of the variant in a case where an alternate molecular basis for disease has been identified. No such data are available.
BP6	Not assessed	BP6 requires a reputable source to have reported the variant as benign. No ClinVar entry or diagnostic laboratory report was identified for this variant.
BP7	N/A	BP7 applies to synonymous variants with no predicted splicing impact. This variant is an in-frame deletion, not a synonymous substitution.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.