LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Variant classification summary
NM_007294.4:c.2657_2676del
BRCA1
· NP_009225.1:p.(Ser886Ter)
· NM_007294.4
GRCh37: chr17:41244871 TTAAGGACCCAGAGTGGGCAG>T
·
GRCh38: chr17:43092854 TTAAGGACCCAGAGTGGGCAG>T
Gene:
BRCA1
Transcript:
NM_007294.4
Final call
Pathogenic
PVS1 very strong
PM5 strong
PM2 supporting
Variant details
Gene
BRCA1
Transcript
NM_007294.4
Protein
NP_009225.1:p.(Ser886Ter)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_007294.4:c.2657_2676del is a 20bp frameshift deletion in BRCA1 exon 10(11) that creates a premature termination codon at p.Ser886Ter. BRCA1 loss of function is an established mechanism for hereditary breast and ovarian cancer.
2
Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PVS1 (Very Strong) as null variants in a gene where loss of function is a known disease mechanism, and PM5_Strong (PTC) because other proven pathogenic PTC variants have been reported in this exon.
3
The variant is absent from gnomAD v2.1 and v4.1 population databases (allele count = 0), meeting PM2 at Supporting strength per ENIGMA population frequency rules.
4
Applying the ENIGMA Table 3 point system: PVS1 Very Strong = 8 points, PM5 Strong = 4 points, PM2 Supporting = 1 point. Total = 13 points, which falls in the Pathogenic range (>=10).
Final determination:
ENIGMA Table 3: 1 Very Strong criterion (PVS1) plus at least 1 Strong criterion (PM5) yields Pathogenic; confirmed by the ENIGMA point system with a total of 13 points (Pathogenic >=10).
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
| Criterion | Status | Rationale | Evidence used |
|---|---|---|---|
| PVS1 | Met | NM_007294.4:c.2657_2676del is a 20bp deletion in BRCA1 exon 10(11) (legacy exon 11) that creates a premature termination codon at p.Ser886Ter. BRCA1 loss of function is an established disease mechanism for hereditary breast and ovarian cancer. Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PVS1 (standard weight, Very Strong). The variant is a canonical null variant expected to trigger nonsense-mediated decay, with the PTC located well upstream of the 3'-most 50 nucleotides of the penultimate exon boundary. |
vcep_specifications_table4_v1_2_2024_11_18
cspec
|
| PS1 | N/A | PS1 applies to predicted missense substitutions with a same-residue pathogenic comparator, or to exonic/intronic variants with the same predicted splicing impact as a known pathogenic variant. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion causing a PTC, not a missense substitution, and SpliceAI predicts no splicing impact (max delta = 0.00). PS1 is not applicable to this variant type. |
cspec
spliceai
|
| PS2 | N/A | PS2 (de novo) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PS3 | N/A | PS3 and BS3 in the ENIGMA BRCA1 framework are applied using Specification Table 9, which contains calibrated mammalian functional assay results for missense and synonymous variants. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC, not a missense or synonymous variant. This variant is not listed in Table 9. PS3 is not applicable to this variant type under the VCEP rules; the damaging effect of a truncating variant is captured by PVS1 rather than PS3. |
cspec
vcep_specifications_table9_v1_2_2024_11_18
|
| PS4 | Not assessed | PS4 requires case-control data with p-value <=0.05 and OR >=4 (lower CI excludes 2.0) per ENIGMA specifications. No structured case-control study data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from ClinVar, precluding aggregate case counting from submitted classifications. Exploratory search suggests this variant has been observed in multiple affected individuals in Southern Italian populations, but quantitative case-control statistics could not be verified from the available evidence. |
cspec
clinvar
|
| PS5 | N/A | PS5 (PP5) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PM1 | N/A | PM1 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PM2 | Met | NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 (non-cancer, exome subset) and gnomAD v4.1 (non-cancer). Per ENIGMA BRCA1 VCEP rules, PM2 is applied at Supporting strength when a variant is absent from controls in an outbred population across both gnomAD versions. |
gnomad_v2
gnomad_v4
cspec
|
| PM4 | N/A | PM4 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PM5 | Met | NM_007294.4:c.2657_2676del creates a premature termination codon (p.Ser886Ter) in BRCA1 exon E10(11). Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PM5_Strong (PTC), as other proven pathogenic PTC variants have been reported in this exon. PM5_PTC is applicable because E10(11) is not in the PM5_N/A exclusion list (which includes only E21(22), E6(7), E7(8) for BRCA1). |
vcep_specifications_table4_v1_2_2024_11_18
cspec
|
| PM6 | N/A | PM6 (de novo) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PP1 | Not assessed | PP1 requires co-segregation data quantified through a likelihood ratio analysis (LR thresholds: Supporting >=2.08, Moderate >=4.3, Strong >=18.7). No co-segregation likelihood ratio data for NM_007294.4:c.2657_2676del is available in the evidence package or ENIGMA supplementary tables. Exploratory evidence suggests this is a founder variant in Southern Italy with reported segregation, but formal LR data could not be verified from available sources. |
cspec
|
| PP2 | N/A | PP2 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| PP3 | N/A | PP3 in the ENIGMA BRCA1 framework applies to missense or in-frame variants inside clinically important functional domains with BayesDel >=0.28, or variants with SpliceAI >=0.2 predicting a splicing effect. NM_007294.4:c.2657_2676del is a frameshift deletion (20bp, not in-frame) creating a PTC. SpliceAI predicts no splicing impact (max delta = 0.00). BayesDel and REVEL scores are not applicable for deletions. The variant does not meet the variant-type prerequisites for PP3 application under ENIGMA rules. |
cspec
spliceai
|
| PP4 | Not assessed | PP4 in the ENIGMA BRCA1 framework is assessed using the clinical-history likelihood ratio from Li et al. 2020 (PMID:31853058). NM_007294.4:c.2657_2676del is not listed in the BRCA1 clinical_history_LR spreadsheet (PMID_31853058_BRCA1_clinical_history_LR.xlsx). A related variant, c.2657_2658delCT, is present in the spreadsheet with LR=1.17 (neutral zone, not meeting PP4 threshold), but this is a different variant. Without a direct LR entry for c.2657_2676del, PP4 cannot be assessed from this source. |
cspec
vcep_pmid_31853058_brca1_clinical_history_lr
|
| PP5 | N/A | PP5 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| BA1 | Not met | BA1 requires filter allele frequency (FAF) above 0.1% (FAF > 0.001) in gnomAD v2.1 (non-cancer, exome only) and/or gnomAD v3.1 (non-cancer), non-founder populations. NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 and v4.1 (allele count = 0). BA1 is not met. |
gnomad_v2
gnomad_v4
cspec
|
| BS1 | Not met | BS1 requires filter allele frequency (FAF) above 0.01% (FAF > 0.0001, Strong) or above 0.002% (FAF > 0.00002, Supporting) in gnomAD. NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 and v4.1 (allele count = 0). BS1 is not met. |
gnomad_v2
gnomad_v4
cspec
|
| BS2 | Not assessed | BS2 is applied in the absence of features of recessive disease (Fanconi Anemia phenotype) and requires points-based assessment per ENIGMA Specifications Table 8. No phenotype or homozygous/compound heterozygous observation data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from gnomAD, making homozygous counts unavailable. BS2 cannot be assessed without observational data in trans with another BRCA1 variant. |
cspec
|
| BS3 | N/A | BS3 in the ENIGMA BRCA1 framework is applied using Specification Table 9, which contains calibrated functional assay results for missense and synonymous variants showing no damaging effect on protein function. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC, not a missense or synonymous variant. It is not listed in Table 9. BS3 is not applicable to this variant type; truncating variant effects are assessed through PVS1 and PM5. |
cspec
vcep_specifications_table9_v1_2_2024_11_18
|
| BS4 | Not assessed | BS4 requires quantitative co-segregation analysis showing lack of segregation in affected family members (LR thresholds: Supporting <=0.48, Moderate <=0.23, Strong <=0.05). No co-segregation likelihood ratio data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from gnomAD, so no observations in presumably unaffected population controls are available to support BS4 either. |
cspec
gnomad_v2
gnomad_v4
|
| BP1 | N/A | BP1 in the ENIGMA BRCA1 framework applies to silent substitutions, missense variants, or in-frame insertions/deletions/delins variants outside clinically important functional domains with no splicing predicted (SpliceAI <=0.1). NM_007294.4:c.2657_2676del is a 20bp frameshift deletion (not in-frame), creating a PTC. The variant type does not meet the BP1 prerequisites under ENIGMA rules. |
cspec
|
| BP2 | N/A | BP2 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| BP3 | N/A | BP3 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification (captured by bioinformatic tool prediction and domain analysis). |
cspec
|
| BP4 | N/A | BP4 in the ENIGMA BRCA1 framework applies to missense or in-frame insertion/deletion/delins variants inside clinically important functional domains with no predicted impact (BayesDel no-AF <=0.15 AND SpliceAI <=0.1), or silent/intronic variants with no splicing predicted. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion (not in-frame) creating a PTC. The variant type does not meet the BP4 prerequisites under ENIGMA rules. |
cspec
spliceai
|
| BP5 | Not assessed | BP5 in the ENIGMA BRCA1 framework is assessed using the clinical-history likelihood ratio from Li et al. 2020 (PMID:31853058), mirroring PP4 in the benign direction. NM_007294.4:c.2657_2676del is not listed in the BRCA1 clinical_history_LR spreadsheet. Without a direct LR entry, BP5 cannot be assessed from this source. |
cspec
vcep_pmid_31853058_brca1_clinical_history_lr
|
| BP6 | N/A | BP6 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. |
cspec
|
| BP7 | N/A | BP7 in the ENIGMA BRCA1 framework applies to intronic and silent variants, and missense/in-frame variants located outside clinically important functional domains, based on mRNA splicing assay evidence. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC. This variant type is not among those eligible for BP7 under ENIGMA rules. The variant produces a truncation, which is assessed through PVS1. |
cspec
|
Disclaimer:
The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.