LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Variant classification summary
NM_004119.3:c.1792_1793insACCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATG
FLT3
· NP_004110.2:p.(Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr)
· NM_004119.3
GRCh37: chr13:28608262 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG
·
GRCh38: chr13:28034125 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG
Gene:
FLT3
Transcript:
NM_004119.3
Final call
Likely Pathogenic
PM1 moderate
PM5 moderate
PS3 supporting
PM2 supporting
Variant details
Gene
FLT3
Transcript
NM_004119.3
Protein
NP_004110.2:p.(Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_004119.3:c.1792_1793insACCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATG (p.Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr) is a novel 20-amino-acid in-frame internal tandem duplication (ITD) in the FLT3 juxtamembrane domain at codons 597-598, within the well-established ITD activating hotspot (codons 589-599).
2
PM1_Moderate is met because the variant maps to the FLT3 juxtamembrane ITD hotspot (codons 589-599), a critical functional domain where recurrent activating ITDs have been established and where no benign population variation is observed in gnomAD. PMID:9737679 documented 47 of 51 FLT3 ITDs in this same codon cluster with constitutive kinase activation.
3
PM5_Moderate is met per the local FLT3 custom framework extension: this is a novel ITD in the same established activating juxtamembrane hotspot class as prior pathogenic FLT3 ITDs. The exact inserted sequence need not have been previously characterized; the event is clearly an ITD analogue in the same hotspot mechanism as established activating FLT3 mutations.
4
PS3_Supporting is met because OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY), and the broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive kinase activation as the canonical mechanism for juxtamembrane ITDs.
5
PM2_Supporting is met because the variant is absent from gnomAD v2.1 and v4.1 (allele frequency 0.0% in all populations).
6
The variant is absent from ClinVar and COSMIC. SpliceAI predicts an acceptor gain (delta 0.45), but this is of uncertain clinical significance for an in-frame ITD with an established gain-of-function mechanism.
7
Applying the local FLT3 ITD / activating length-mutation framework with generic ACMG/AMP 2015 final combination rules: 2 Moderate criteria (PM1, PM5) plus 2 Supporting criteria (PS3, PM2) meets the threshold for Likely Pathogenic (2 Moderate + >=2 Supporting).
Final determination:
Two Moderate criteria (PM1, PM5) plus two Supporting criteria (PS3, PM2) satisfies the Likely Pathogenic rule '2 Moderate + >=2 Supporting' under the local FLT3 ITD custom framework, which follows generic ACMG/AMP 2015 final combination thresholds.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
| Criterion | Status | Rationale | Evidence used |
|---|---|---|---|
| PVS1 | N/A | This is an in-frame insertion in the juxtamembrane domain, not a nonsense, frameshift, or canonical ±1,2 splice site variant. PVS1 is not applicable to in-frame ITD events under ClinGen SVI PVS1 guidelines (PMC6185798). |
pvs1_generic_framework
|
| PS1 | N/A | PS1 applies to different nucleotide changes at the same amino acid position with prior pathogenic classification. This variant is a 60-bp in-frame insertion, not a single-nucleotide substitution. |
|
| PS2 | N/A | No de novo data are available for this variant. |
|
| PS3 | Met | OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY). The broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive activation of the FLT3 kinase as the canonical mechanism for juxtamembrane ITDs. Per the local FLT3 custom framework, this exact-variant OncoKB functional/mechanistic annotation together with class-level FLT3 ITD activation literature is sufficient for PS3_Supporting. |
oncokb
PMID:9737679
PMID:11090077
PMID:11756186
|
| PS4 | N/A | No case-control or observational cohort data are available for this variant in a germline context. |
|
| PS5 | N/A | PS5 is applicable only to recessive disorders. |
|
| PM1 | Met | The variant maps to codons 597-598 in the FLT3 juxtamembrane domain, which lies within the well-established ITD activating hotspot cluster at codons 589-599. Mutalyzer normalization (NM_004119.3:c.1793_1794ins[CCTTCCT;1741_1793]) confirms this is a tandem duplication event producing an in-frame ITD in the canonical juxtamembrane region. This region is a critical functional domain where no benign population variation is observed (absent from gnomAD v2.1 and v4.1). The literature consistently identifies this region as a recurrent mutational hotspot in AML where ITDs constitutively activate FLT3 kinase (PMID:9737679 reported 47/51 FLT3 ITDs in codons 589-599). Per the local FLT3 custom framework, PM1_Moderate is applicable. |
gnomad_v2
gnomad_v4
PMID:9737679
PMID:11090077
PMID:11756186
vcep_flt3_itd_hotspot_and_function
oncokb
|
| PM2 | Met | The variant is absent from gnomAD v2.1 and v4.1 (population databases encompassing >250,000 alleles), meeting the PM2 threshold of allele frequency <0.1% in all populations. This variant has not been observed in any healthy population cohort. |
gnomad_v2
gnomad_v4
|
| PM3 | N/A | Skipped per instructions — PM3 was explicitly excluded from assessment. |
|
| PM4 | N/A | Per the local FLT3 custom framework, PM4 is not separately applied when PM1 and PM5 already capture the hotspot and established activating mechanism for this juxtamembrane ITD event. The protein length change rationale is already represented by PM1 and PM5. |
vcep_flt3_itd_hotspot_and_function
|
| PM5 | Met | Per the local FLT3 custom framework extension of PM5 beyond missense-only wording: this is a novel in-frame ITD at codons 597-598 that falls within the established activating juxtamembrane ITD hotspot class (codons 589-599). Multiple prior pathogenic/oncogenic FLT3 ITDs are established for this hotspot (PMID:9737679 documented 47/51 ITDs in this region). The exact inserted sequence need not have been previously characterized; the event is clearly an ITD / activating length-mutation analogue in the same hotspot mechanism as prior established pathogenic FLT3 ITDs. |
PMID:9737679
PMID:11090077
PMID:11756186
PMID:12384447
vcep_flt3_itd_hotspot_and_function
vcep_flt3_oncokb_guidance
oncokb
|
| PM6 | N/A | No de novo data are available for this variant. |
|
| PP1 | N/A | No segregation data are available for this variant. |
|
| PP2 | N/A | PP2 applies to missense variants in genes where missense is a common disease mechanism. This is an in-frame insertion (ITD), not a missense substitution. |
|
| PP3 | N/A | SpliceAI predicts an acceptor gain with delta score 0.45, but the established pathogenic mechanism for FLT3 juxtamembrane ITDs is gain-of-function via disruption of the autoinhibitory JM domain leading to constitutive kinase activation, not aberrant splicing. The SpliceAI signal is of uncertain relevance for an in-frame ITD where the primary functional effect is well-characterized at the protein level. PP3 is not separately applied. |
spliceai
|
| PP4 | N/A | No phenotype-specific data are available for this variant in a clinical diagnostic setting. |
|
| PP5 | N/A | This variant is absent from ClinVar. No reputable source has classified this variant as pathogenic. |
clinvar
|
| BA1 | Not met | The variant is absent from gnomAD (v2.1 and v4.1). The BA1 threshold of >1% allele frequency is not met. |
gnomad_v2
gnomad_v4
|
| BS1 | Not met | The variant is absent from gnomAD. The BS1 threshold of >0.3% allele frequency is not met. |
gnomad_v2
gnomad_v4
|
| BS2 | N/A | No observation in healthy adult individuals is documented for this variant. |
|
| BS3 | N/A | No well-established in vitro or in vivo functional studies demonstrating no damaging effect are available for this variant. The available functional evidence supports a gain-of-function mechanism. |
|
| BS4 | N/A | No segregation data are available to assess lack of cosegregation with disease. |
|
| BP1 | N/A | BP1 applies to missense variants in genes where a truncating mechanism is the primary cause of disease. This is an in-frame insertion (ITD), not a missense substitution. |
|
| BP2 | N/A | No observation in trans with a known pathogenic variant is available for this variant. |
|
| BP3 | Not met | Per the local FLT3 custom framework, BP3 is not applied to FLT3 in-frame ITDs or activating length mutations in the juxtamembrane hotspot region because this region has a known activating disease mechanism and recurrent pathogenic/oncogenic variation. The insertion is not in a repetitive region without known function. |
vcep_flt3_itd_hotspot_and_function
PMID:9737679
|
| BP4 | N/A | No multiple lines of computational evidence suggest no impact on gene product. SpliceAI delta score of 0.45 does not support a benign interpretation, and REVEL/BayesDel are not available for insertions. |
spliceai
|
| BP5 | N/A | This variant is absent from ClinVar. No reputable source has classified this variant as benign. |
clinvar
|
| BP6 | N/A | This variant is absent from ClinVar. No reputable source has classified this variant as benign. |
clinvar
|
| BP7 | N/A | BP7 applies to synonymous (silent) variants. This is a 60-bp in-frame insertion resulting in a 20-amino-acid protein insertion. |
|
Disclaimer:
The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.