LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-06-24
Case ID: NM_000455.4_c.539_571delinsTGGTAGGGTGGCACCTC_20260624_122212
Framework: ACMG/AMP 2015
Variant classification summary

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC

STK11  · NP_000446.1:p.(Gly180ValfsTer102)  · NM_000455.4
GRCh37: chr19:1220446 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC  ·  GRCh38: chr19:1220447 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC
Gene: STK11 Transcript: NM_000455.4
Final call
VUS
PVS1 very strong PM2 supporting
All criteria require review: For research and educational purposes only.
Variant details
Gene
STK11
Transcript
NM_000455.4
Protein
NP_000446.1:p.(Gly180ValfsTer102)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is a frameshift variant predicted to cause p.(Gly180ValfsTer102) with a premature termination codon at residue 281, expected to trigger nonsense-mediated decay. Loss of function is an established disease mechanism for STK11 in Peutz-Jeghers syndrome.
2
The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada population databases, supporting its rarity in the general population.
3
The variant is absent from ClinVar and has not been reported in affected individuals, in somatic cancer databases (COSMIC), or in any of the five gene-level functional publications reviewed.
4
No variant-specific functional studies, segregation data, de novo observations, or case-control data were identified. Five publications retrieved via OncoKB discuss STK11 function at the gene level but none include NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC.
5
Under the ClinGen SVI PVS1 decision framework (PMC6185798), a frameshift variant upstream of the last exon in a gene with an established loss-of-function disease mechanism qualifies for PVS1 at full strength.
Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 Met Frameshift variant NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC predicts p.(Gly180ValfsTer102), introducing a premature termination codon at residue 281 within exon 4 of 9 coding exons. Loss of function is a well-established disease mechanism for STK11 in Peutz-Jeghers syndrome. The predicted transcript is expected to undergo nonsense-mediated decay per the ClinGen SVI PVS1 decision framework (PMC6185798).
pvs1_generic_framework pvs1_gene_context pvs1_variant_assessment
PS1 N/A PS1 applies to same amino acid change as an established pathogenic variant. This variant is a frameshift, not a missense substitution.
PS2 Not met No de novo observation has been reported for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC in any reviewed publication or database.
PS3 Not met No variant-specific functional studies were identified for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Five publications retrieved via OncoKB discuss STK11/LKB1 function at the gene level but none include this specific variant in functional assays.
PS4 Not met The variant is absent from ClinVar and has not been observed in affected individuals in any reviewed source. No case-control or statistical enrichment data are available.
clinvar
PS5 N/A PS5 applies to missense variants at a residue where a different pathogenic missense has been established. This variant is a frameshift.
PM1 N/A PM1 applies to missense variants in a mutational hotspot or critical functional domain without benign variation. This variant is a frameshift; the loss-of-function effect is already fully captured by PVS1, and applying PM1 would constitute double-counting.
PM2 Met NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, indicating it is not observed in large population cohorts.
gnomad_v2 gnomad_v4 gnomad_canada
PM3 N/A Trivially not applicable per case instructions.
PM4 N/A PM4 applies to in-frame deletions/insertions or stop-loss variants. This variant is a frameshift (out-of-frame delins), which is addressed by PVS1.
PM5 N/A PM5 applies to novel missense variants at a residue where a different pathogenic missense has been established. This variant is a frameshift; no same-residue missense comparator exists. Automated PM5 candidate harvesting confirmed no eligible comparators.
pm5_candidates
PM6 Not met No de novo observation has been reported for this variant in any reviewed publication or database. PMID:22118009 reports a different STK11 de novo variant (c.698_699insG), not NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC.
PP1 Not met No segregation data are available for this variant. No family studies have been reported.
PP2 N/A PP2 applies to missense variants in genes with a low rate of benign missense variation. This variant is a frameshift, not a missense.
PP3 Not met In silico tools applicable to indels are limited. SpliceAI predicts a moderate splice impact (max delta score 0.47), but REVEL and BayesDel are not applicable to this variant type. Multiple lines of computational evidence supporting a deleterious effect are not available.
spliceai
PP4 Not met No phenotype or family history data specific to this variant are available. The variant is absent from ClinVar and has not been reported in any affected individual.
PP5 Not met The variant is absent from ClinVar. No reputable source has classified this variant as pathogenic.
clinvar
BA1 Not met Allele frequency is 0% across all gnomAD datasets, well below the BA1 threshold of >1%.
gnomad_v2 gnomad_v4 gnomad_canada
BS1 Not met Allele frequency is 0% across all gnomAD datasets, well below the BS1 threshold of >0.3%.
gnomad_v2 gnomad_v4 gnomad_canada
BS2 Not met The variant has not been observed in any healthy adult control population. It is absent from all gnomAD datasets.
gnomad_v2 gnomad_v4 gnomad_canada
BS3 Not met No variant-specific functional studies were identified demonstrating no deleterious effect for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Five gene-level functional publications were reviewed but none tested this variant.
BS4 Not met No segregation or non-segregation data are available. No family studies involving this variant have been reported.
BP1 N/A BP1 applies to missense variants in genes where primarily truncating variants cause disease. This variant is itself a truncating (frameshift) variant.
BP2 Not met No observation of this variant in trans with a known pathogenic STK11 variant has been reported.
BP3 N/A BP3 applies to in-frame deletions or insertions in a repetitive region without known function. This variant is an out-of-frame (frameshift) alteration.
BP4 Not met Multiple lines of computational evidence do not suggest a benign effect. SpliceAI predicts a moderate splice alteration (max delta 0.47). REVEL and BayesDel are not applicable to this variant type, so comprehensive benign computational consensus cannot be established.
spliceai
BP5 Not met No observation of this variant in a case where an alternate molecular basis for disease has been identified.
BP6 Not met No reputable source has classified this variant as benign. The variant is absent from ClinVar entirely.
clinvar
BP7 N/A BP7 applies to synonymous variants with no predicted splice impact. This variant is a frameshift alteration.
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.