Variant classification summary

NM_000314.6:c.33_54delAAACAAAAGGAGATATCAAGAG

PTEN · NP_000305.3:p.(Asn12MetfsTer5) · NM_000314.6

GRCh37: chr10:89624256 CAGAAACAAAAGGAGATATCAAG>C · GRCh38: chr10:87864499 CAGAAACAAAAGGAGATATCAAG>C

Gene: PTEN Transcript: NM_000314.6

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.6

Protein

NP_000305.3:p.(Asn12MetfsTer5)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

NM_000314.6:c.33_54del is a 22 bp deletion in exon 1 of PTEN causing a frameshift (p.Asn12MetfsTer5) predicted to undergo nonsense-mediated decay, assigned PVS1 at very strong strength under the PTEN VCEP decision tree.

2

The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0, meeting PM2 at supporting strength under PTEN VCEP specifications.

3

The variant is absent from ClinVar; no functional studies, segregation data, case observations, or de novo reports were identified in the reviewed literature.

4

Under the PTEN VCEP combination rules (Rule20, pathogenic track), PVS1 (Very Strong) plus one Supporting criterion (PM2_Supporting) yields a final classification of Likely Pathogenic.

Final determination: Rule20 in the Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework is satisfied by the adjudicated criteria, so the variant is classified as Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	NM_000314.6:c.33_54del is a 22 bp frameshift deletion in exon 1 producing a premature stop codon at position 16 (p.Asn12MetfsTer5), well 5' to the PTEN NMD threshold at p.D375 (c.1121). Under the PTEN VCEP PVS1 decision tree, a frameshift variant with stop codon at or 5' to p.D375 that is predicted to undergo nonsense-mediated decay in a biologically-relevant transcript is assigned PVS1 at very strong strength.	cspec pvs1_variant_assessment pvs1_gene_context
PS1	N/A	PS1 applies to same amino acid change as a known pathogenic variant or different variant at same nucleotide position. This is a 22 bp frameshift deletion, not a single nucleotide substitution, and does not produce a missense change that can be compared with known pathogenic missense variants.
PS2	Not met	No de novo observation of this variant has been reported. The variant is absent from ClinVar and no papers describe de novo occurrence.
PS3	Not met	PTEN VCEP PS3 criteria apply to RNA/mini-gene splicing assays (Strong) or phosphatase activity via Mighell et al. 2018 saturation mutagenesis (Moderate/Supporting). No splicing assay data are available for this variant, and the Mighell et al. 2018 assay (mmc2.xlsx) covers only missense variants. This is a frameshift variant and is not represented in that dataset.
PS4	Not met	PTEN VCEP PS4 requires proband specificity scores. The variant is absent from ClinVar and no proband observations have been reported. Insufficient case-level data to apply PS4 at any strength level.
PS5	N/A	PS5 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee.
PM1	Not met	PTEN VCEP defines PM1 for residues in catalytic motifs: WPD loop (90-94), P-loop (123-130), and TI-loop (166-168). This frameshift occurs at codon 12 (p.Asn12MetfsTer5), well outside any catalytic domain. The variant does not lie in a mutational hotspot or critical functional domain.
PM2	Met	This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0. Under PTEN VCEP specifications, PM2 is applied at supporting strength when a variant is absent from population databases (allele frequency < 0.00001 / 0.001%).	gnomad_v2 gnomad_v4 gnomad_canada
PM3	N/A	PM3 is not applicable to PTEN — PTEN is an autosomal dominant disorder gene (PHTS) and this rule is for recessive disorders per PTEN VCEP specification.
PM4	N/A	PTEN VCEP PM4 applies to in-frame deletions/insertions impacting catalytic motif residues or variants causing protein extension. This variant is a 22 bp out-of-frame (frameshift) deletion causing premature truncation at codon 16, not an in-frame change. PM4 is not applicable to frameshift variants.
PM5	N/A	PTEN VCEP PM5 applies to missense changes at a residue where a different pathogenic missense change has been reported. This is a frameshift variant, not a missense substitution. PM5 candidate analysis confirmed no comparator variants applicable.	pm5_candidates
PM6	Not met	No assumed de novo observations have been reported for this variant. The variant is absent from ClinVar and no publications describe de novo occurrence.
PP1	Not met	No co-segregation data are available for this variant. No family studies or meiotic data have been reported.
PP2	N/A	PTEN VCEP PP2 applies to missense variants in a gene with low rate of benign missense variation where missense variants are a common disease mechanism. This is a frameshift variant, not a missense change.
PP3	Not met	PTEN VCEP PP3 applies to splicing variants with SpliceAI/VarSeak concordance or missense variants with REVEL > 0.7. SpliceAI max delta score is 0.13 (well below pathogenic threshold of 0.5). REVEL is not applicable (this is an indel, not a single nucleotide variant). No multiple lines of computational evidence support a deleterious effect.	spliceai
PP4	N/A	PP4 is designated not applicable by the ClinGen PTEN VCEP — phenotype specificity has been incorporated into PS4 rule specifications.
PP5	N/A	PP5 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee.
BA1	Not met	PTEN VCEP BA1 requires gnomAD filtering allele frequency > 0.00056 (0.056%). This variant is absent from all gnomAD datasets.	gnomad_v2 gnomad_v4
BS1	Not met	PTEN VCEP BS1 requires gnomAD filtering allele frequency ≥ 0.0000043 (0.00043%) for supporting or ≥ 0.000043 (0.0043%) for strong. This variant is absent from all gnomAD datasets.	gnomad_v2 gnomad_v4
BS2	Not met	PTEN VCEP BS2 requires observation in the homozygous state in a healthy or PHTS-unaffected individual. No such observations have been reported.
BS3	Not met	PTEN VCEP BS3 applies to intronic/synonymous variants showing no splicing impact (Strong) or phosphatase activity > 0 via Mighell et al. 2018 (Supporting). No experimental data demonstrate an absence of damaging effect for this variant. The Mighell et al. assay is limited to missense variants.
BS4	Not met	PTEN VCEP BS4 requires lack of segregation in affected family members. No segregation data are available for this variant.
BP1	N/A	BP1 is designated not applicable to PTEN by the ClinGen PTEN VCEP.
BP2	Not met	PTEN VCEP BP2 requires observation in trans with a pathogenic/likely pathogenic PTEN variant or at least three observations in cis/unknown phase with different P/LP variants. No such observations have been reported.
BP3	N/A	BP3 is designated not applicable to PTEN by the ClinGen PTEN VCEP. This rule for in-frame deletions/insertions in repetitive regions is not applicable to this gene.
BP4	N/A	PTEN VCEP BP4 applies to synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact, or missense variants with REVEL < 0.5. This is a coding frameshift deletion, not a synonymous/intronic variant, and REVEL is not applicable.
BP5	Not met	PTEN VCEP BP5 requires at least two cases where the variant is found with an alternate molecular basis for disease. No such cases have been reported for this variant.
BP6	N/A	BP6 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee.
BP7	N/A	PTEN VCEP BP7 applies to synonymous or intronic variants at or beyond +7/-21 for which splicing algorithms predict no impact. This is a 22 bp coding frameshift deletion, not a synonymous or deep intronic variant.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.