LYFE Sciences · Project HERA

Variant Interpretation · Classification Report

Generated: 2026-06-26

Case ID: NM_203407.3_c.860_892delGCCCTGCCCGCCGAGGCCGCGATTCTGCGCCAG_20260626_183048

Framework: ACMG/AMP 2015

Variant classification summary

NM_203407.3:c.860_892delGCCCTGCCCGCCGAGGCCGCGATTCTGCGCCAG

EZHIP · NP_981952.1:p.(Gly287_Pro297del) · NM_203407.3

GRCh37: chrX:51150712 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T · GRCh38: chrX:51407860 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T

Gene: EZHIP Transcript: NM_203407.3

Final call

VUS

PM2 supporting PM4 moderate

Variant details

Gene

EZHIP

Transcript

NM_203407.3

Protein

NP_981952.1:p.(Gly287_Pro297del)

gnomAD AF

2.3885774551360847e-05 (v4.1)

ClinVar

OncoKB

Unknown Oncogenic Effect

Classification rationale

Interpretation summary

Generated evidence synthesis

NM_203407.3:c.860_892del (p.Gly287_Pro297del) is an in-frame deletion of 11 amino acids within exon 1 of EZHIP, a gene for which loss-of-function is a supported germline disease mechanism.

This variant is extremely rare in population databases, with an allele frequency of 0.00135% in gnomAD v2.1 (2/147,648 alleles) and 0.00239% in gnomAD v4.1 (13/544,257 alleles), meeting PM2 at supporting strength.

As an in-frame deletion in a non-repeat region, the variant meets PM4 at moderate strength per generic ACMG/AMP criteria.

PVS1 is not applicable as this in-frame deletion does not fall into the null-variant buckets (nonsense, frameshift, or canonical splice) defined by the ClinGen SVI PVS1 framework.

No computational evidence supports pathogenicity (SpliceAI max delta = 0.04; REVEL/BayesDel not applicable to deletions), so PP3 is not met.

The variant is absent from ClinVar, and no functional studies, cosegregation data, or de novo reports were identified. Multiple criteria (PS2, PS3, PS4, PS5, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5) remain unassessed due to lack of evidence.

Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	N/A	NM_203407.3:c.860_892del is an in-frame deletion (p.Gly287_Pro297del) removing 11 amino acids. This variant does not fall into any ClinGen SVI PVS1 null-variant bucket (nonsense, frameshift, or canonical ±1,2 splice consensus). Generic PVS1 framework is not applicable to in-frame deletions.	pvs1_generic_framework
PS1	N/A	Variant is absent from ClinVar with no prior pathogenic or likely pathogenic classification by any submitter. No same-variant classification exists to apply PS1.	clinvar
PS2	Not assessed	No de novo data available. No publications reporting de novo occurrence of this variant were identified.
PS3	Not assessed	No variant-specific functional studies identified. OncoKB classifies this variant as 'Unknown Oncogenic Effect' and no literature with functional evidence for this variant was found.	oncokb
PS4	Not assessed	No case-control or prevalence data available. The variant is absent from ClinVar and no affected-vs-control population data were identified.
PS5	Not assessed	No evidence of this variant occurring in trans with a pathogenic variant. EZHIP is X-linked, further complicating trans analysis.
PM1	Not met	This variant does not lie in a statistically significant mutational hotspot. Hotspot analysis returned no significance for the deleted region. No gene-specific functional domain mapping is available for PM1 adjudication.
PM2	Met	This variant is extremely rare in population databases. gnomAD v2.1 reports an allele frequency of 0.00135% (2/147,648 alleles, 0 homozygotes). gnomAD v4.1 reports 0.00239% (13/544,257 alleles, 0 homozygotes, grpmax FAF = 2.23 × 10⁻⁵). The variant is absent from gnomAD-Canada. All observed frequencies are well below the 0.1% threshold for PM2 under generic ACMG/AMP.	gnomad_v2 gnomad_v4 gnomad_canada
PM3	N/A	PM3 (trans with pathogenic variant in recessive disorder) skipped per user directive.
PM4	Met	NM_203407.3:c.860_892del is an in-frame deletion removing 11 amino acids (p.Gly287_Pro297del) within a non-repeat region of EZHIP. In-frame deletions in non-repeat regions meet PM4 at moderate strength under generic ACMG/AMP. The deleted region spans residues 287–297 in exon 1 with no evidence of being a repetitive domain.	pvs1_generic_framework
PM5	N/A	PM5 applies to missense variants at the same residue as a known pathogenic missense change. This variant is an in-frame deletion, not a missense substitution, and cannot be evaluated under the classic same-residue PM5 framework.	pm5_candidates
PM6	Not assessed	No de novo data available. No publications reporting de novo occurrence of this variant were identified.
PP1	Not assessed	No cosegregation data available. No family studies reporting this variant were identified.
PP2	N/A	PP2 applies to missense variants in genes with a low rate of benign missense variation. This variant is an in-frame deletion, not a missense substitution.
PP3	Not met	No computational evidence supports a deleterious effect. SpliceAI predicts no significant splice impact (max delta = 0.04). REVEL and BayesDel are not applicable to in-frame deletions. HCI prior is not supported for EZHIP. No in silico protein structure tools assessed.	spliceai
PP4	Not assessed	No patient phenotype or clinical data were provided for this case.
PP5	N/A	This variant is absent from ClinVar. No expert panel or reputable source has classified this variant, and no VCEP/CSPEC exists for EZHIP.	clinvar
BA1	Not met	The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BA1 threshold of >1%.	gnomad_v2 gnomad_v4
BS1	Not met	The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BS1 threshold of >0.3%.	gnomad_v2 gnomad_v4
BS2	Not assessed	This variant is observed at extremely low frequency in gnomAD (2 of 147,648 alleles in v2.1; 13 of 544,257 alleles in v4.1) with zero homozygotes. However, carrier phenotype data are not available, and EZHIP is on the X chromosome, which complicates BS2 assessment without knowing whether carriers were healthy adult hemizygous males or heterozygous females with full penetrance expected early.	gnomad_v2 gnomad_v4
BS3	Not assessed	No well-established functional studies showing no deleterious effect are available for this variant.
BS4	Not assessed	No segregation data available. No family studies reporting lack of segregation with disease were identified.
BP1	N/A	BP1 applies to missense variants in genes where primarily truncating variants cause disease. This variant is an in-frame deletion, not a missense substitution.
BP2	Not assessed	No data available on whether this variant has been observed in trans with a pathogenic variant or in cis with a pathogenic variant. EZHIP is X-linked, which further limits standard BP2 assessment.
BP3	Not met	This in-frame deletion spans residues 287–297 in exon 1 of EZHIP. There is no evidence confirming this region is a repetitive domain without known function. The deleted sequence contains GC-rich motifs but is not established as a functionally inert repetitive region.
BP4	Not met	SpliceAI predicts no significant splice impact (max delta = 0.04). However, this is an in-frame deletion whose primary effect is at the protein level, and no protein-level computational tools (e.g., for structural impact of in-frame deletions) were applied. The single line of evidence (SpliceAI) is insufficient to meet BP4.	spliceai
BP5	Not assessed	No evidence of an alternate molecular basis for disease was identified in this case.
BP6	N/A	This variant is absent from ClinVar with no reputable source classifying it as benign or likely benign.	clinvar
BP7	N/A	BP7 applies to synonymous variants with no predicted splice impact. This variant is an in-frame deletion, not a synonymous substitution.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.