NM_002067.5:c.735+1_736-1del

GNA11 · NP_002058.2:p.? · NM_002067.5

GRCh37: chr19:3119049 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G · GRCh38: chr19:3119051 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G

Gene: GNA11 Transcript: NM_002067.5

Final call

Likely Pathogenic

PVS1 very strong PM2 moderate

Variant details

Gene

GNA11

Transcript

NM_002067.5

Protein

NP_002058.2:p.?

gnomAD AF

1.2393094072259175e-06 (v4.1)

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

NM_002067.5:c.735+1_736-1del is a canonical splice site deletion removing the donor (+1) and acceptor (-1) sites of intron 5 of GNA11, qualifying for PVS1 at very strong strength under ClinGen SVI PVS1 recommendations (PMC6185798), with GNA11 loss of function established as a germline disease mechanism.

The variant is absent from gnomAD v2.1 and is observed at an extremely low frequency in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, 0 homozygotes), meeting PM2 at moderate strength.

Per generic ACMG/AMP 2015 combination rules (Richards et al., PMID:25741868), one Very Strong criterion (PVS1) plus one Moderate criterion (PM2) yields a classification of Likely Pathogenic.

Final determination: Generic ACMG/AMP 2015 fallback rules support a Likely Pathogenic classification based on the observed combination of pathogenic criteria.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	NM_002067.5:c.735+1_736-1del deletes the canonical splice donor (+1) and acceptor (-1) sites of intron 5, abrogating normal splicing. GNA11 loss of function is an established germline disease mechanism supported by targeted literature review. SpliceAI predicts strong splice disruption (max delta score = 1.00, with both donor loss and acceptor loss predicted at delta = 1.0). Per ClinGen SVI PVS1 recommendations (PMC6185798), canonical ±1,2 splice variants qualify for PVS1 at very strong strength in genes with established LoF mechanism. No downgrade factors identified.	pvs1_generic_framework gnomad_v4 spliceai
PS1	N/A	This is a canonical splice site deletion with unknown protein consequence (p.?). PS1 requires a same-amino-acid change comparator from a known pathogenic variant, which is not applicable to splice variants.
PS2	Not assessed	No de novo data are available for this variant. PS2 requires confirmed de novo occurrence with both maternity and paternity confirmed.
PS3	Not met	No well-established functional studies have been identified for NM_002067.5:c.735+1_736-1del. COSMIC COSV107230858 reports a single somatic observation (n=1), which does not constitute well-established functional evidence under ACMG/AMP guidelines.
PS4	Not met	No case-control or odds ratio data are available comparing the prevalence of this variant in affected individuals versus the general population. While the variant is extremely rare in gnomAD v4.1 (AF = 1.24e-06), this alone does not satisfy PS4 without affected cohort data.	gnomad_v4
PS5	N/A	PS5 is not a standard criterion in the ACMG/AMP 2015 sequence variant interpretation framework (Richards et al., PMID:25741868).
PM1	Not met	This variant is not located in an established mutational hotspot or critical functional domain for GNA11. The hotspot assessment identified no significant residue-level hotspot and the variant was not listed in curated hotspot databases.
PM2	Met	NM_002067.5:c.735+1_736-1del is absent from gnomAD v2.1 and extremely rare in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, no homozygotes). The population frequency (0.00012%) is well below the 0.1% PM2 threshold for non-VCEP adjudication. Absent from gnomAD-Canada v1.0.	gnomad_v2 gnomad_v4 gnomad_canada
PM3	N/A	Skipped per adjudication directive. PM3 (in trans with pathogenic variant for recessive disorders) not assessed for this case.
PM4	N/A	PM4 applies to in-frame deletions/insertions in non-repeat regions or stop-loss variants resulting in protein length changes. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion with unknown protein consequence (p.?); PM4 is not applicable to splice variants without confirmed in-frame outcome.
PM5	N/A	PM5 requires a same-residue missense change from a known pathogenic variant. This splice variant has unknown protein consequence (p.?), and the PM5 candidate assessment confirmed eligible_for_classic_pm5_search = false. No same-residue comparator can be identified.
PM6	Not assessed	No de novo data are available for this variant. PM6 requires a de novo observation with confirmed maternity and paternity, or a de novo observation with unconfirmed parentage (supporting strength).
PP1	Not assessed	No segregation data are available for this variant. PP1 requires cosegregation with disease in multiple affected family members.
PP2	N/A	PP2 applies specifically to missense variants in genes with a low rate of benign missense variation and where missense is a common disease mechanism. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a missense variant.
PP3	Not met	SpliceAI predicts strong splice disruption (max delta = 1.00, DS_AL = 1.00, DS_DL = 1.00). However, per ClinGen SVI PVS1 recommendations (PMC6185798), PP3 should not be stacked with PVS1 for the same splice-effect prediction evidence. The splice prediction data are already captured in the PVS1 assessment at very strong strength. REVEL and BayesDel scores are not available (not an SNV). HCI prior is not available for GNA11.	spliceai
PP4	Not met	No patient phenotype or family history data are available for this case. PP4 requires that the patient's phenotype or family history is highly specific for a disease with a single genetic etiology.
PP5	Not met	NM_002067.5:c.735+1_736-1del is absent from ClinVar. No reputable source has reported this variant as pathogenic.	clinvar
BA1	Not met	The highest subpopulation allele frequency for NM_002067.5:c.735+1_736-1del in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population. This is well below the 1% BA1 threshold for non-VCEP adjudication.	gnomad_v4
BS1	Not met	The highest subpopulation allele frequency in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population. This is well below the 0.3% BS1 threshold for non-VCEP adjudication.	gnomad_v4
BS2	Not met	Two heterozygous carriers are observed in gnomAD v4.1 (2/1,613,802 alleles), but no phenotype data are available for these individuals. BS2 requires observation in a healthy adult individual for a fully penetrant disorder expected to occur at an early age. Two heterozygotes without phenotype confirmation are insufficient to satisfy BS2.	gnomad_v4
BS3	Not met	No well-established functional studies have been identified that demonstrate no damaging effect of this variant on the gene product. The SpliceAI prediction (max delta = 1.00) indicates a strong deleterious splice effect, contrary to a benign functional interpretation.	spliceai
BS4	Not met	No family segregation data are available for this variant. BS4 requires lack of segregation with disease in affected family members.
BP1	Not met	BP1 applies to missense variants in genes where truncating variants are the primary known disease mechanism. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a missense variant. BP1 does not apply.
BP2	Not met	No data are available regarding observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder. None of the reviewed literature or databases provide such evidence.
BP3	Not met	BP3 applies to in-frame deletions or insertions in repetitive regions without a known function. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not an in-frame deletion. BP3 does not apply.
BP4	Not met	Multiple lines of computational evidence do NOT suggest a benign impact. SpliceAI predicts strong splice disruption (max delta = 1.00; DS_AL = 1.00, DS_DL = 1.00), supporting a deleterious effect on splicing. No in silico evidence suggests a benign interpretation.	spliceai
BP5	Not met	No data are available identifying an alternate molecular basis for disease in an individual carrying this variant. No case-level data are available for this variant at all.
BP6	Not met	NM_002067.5:c.735+1_736-1del is absent from ClinVar. No reputable source has reported this variant as benign.	clinvar
BP7	Not met	BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a synonymous variant. BP7 does not apply.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.