LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Variant classification summary
CDKN2A
· NP_000068.1:p.(Ala4_Pro11del)
· NM_000077.4
GRCh37: chr9:21974794 AGGCTCCATGCTGCTCCCCGCCGCC>A
·
GRCh38: chr9:21974795 AGGCTCCATGCTGCTCCCCGCCGCC>A
Gene:
CDKN2A
Transcript:
NM_000077.4
Final call
Variant details
Gene
CDKN2A
Transcript
NM_000077.4
Protein
NP_000068.1:p.(Ala4_Pro11del)
gnomAD AF
9.524022947292936e-05 (v4.1)
ClinVar
Uncertain significance
OncoKB
Unknown Oncogenic Effect
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_000077.4:c.9_32del (p.Ala4_Pro11del) is an in-frame 24-bp deletion removing 8 amino acids from the N-terminus of p16 in CDKN2A.
2
This deletion does not qualify as a null variant under the ClinGen SVI PVS1 framework (PMC6185798) and PVS1 is not applicable.
3
The variant is present in gnomAD v2.1 at 36/265,240 alleles (AF=0.0136%) and in gnomAD v4.1 at 153/1,606,464 alleles (AF=0.0095%) including one homozygote. These population frequencies are inconsistent with a high-penetrance pathogenic variant in a dominant cancer predisposition gene.
4
One homozygote is observed in gnomAD v4.1 (BS2_supporting). Homozygosity for a pathogenic CDKN2A variant would be expected to produce a severe phenotype, and its presence in a population database argues against high penetrance pathogenicity.
5
Functional studies demonstrate no damaging effect on p16 function. The N-terminal domain outside the ankyrin repeats is dispensable (PMID:8668202), and the specific 24-bp deletion mutant shows normal CDK4 binding (PMID:11159196) (BS3_supporting).
6
The deletion occurs within a repetitive sequence region of CDKN2A exon 1 with 25 possible deletion variants yielding the same sequence alteration; both deletions and duplications have been documented at this site (BP3_supporting).
7
SpliceAI predicts no significant splicing impact (max delta score = 0.06) (BP4_supporting).
8
The variant has been observed in melanoma-affected families (PMID:10070944, PMID:16905682, PMID:25780468) and is reported as a variant of uncertain significance by 13 clinical laboratories in ClinVar, with one laboratory classifying it as likely benign. No expert panel has adjudicated this variant.
9
Applying generic ACMG/AMP 2015 combination rules (PMID:25741868): the criteria met are BS2_supporting, BS3_supporting, BP3_supporting, and BP4_supporting. Four supporting benign criteria would satisfy 'Likely Benign' classification (≥2 supporting benign). However, the presence of a homozygous individual in gnomAD, taken together with functional evidence of normal protein activity and location in a repetitive region, supports a classification of Likely Benign.
Final determination:
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
| Criterion | Status | Rationale | Evidence used |
|---|---|---|---|
| PVS1 | N/A | This is an in-frame 24-bp deletion in exon 1 (p.Ala4_Pro11del) that does not fall into the default PVS1 null-variant buckets of nonsense, frameshift, or canonical ±1,2 splice consensus variants per the ClinGen SVI PVS1 framework (PMC6185798). PVS1 is not applicable to in-frame deletions of this class. |
pvs1_variant_assessment
pvs1_generic_framework
|
| PS1 | N/A | PS1 requires a nucleotide change at the same position as a known pathogenic missense variant. This variant is a 24-bp deletion, not a single-nucleotide substitution; PS1 does not apply to deletions. |
|
| PS2 | Not assessed | No de novo evidence is available for this variant. None of the reviewed publications or ClinVar submissions reported a confirmed de novo occurrence. |
|
| PS3 | Not met | Available functional evidence does not support a damaging effect for this variant. Parry & Peters (PMID:8668202) demonstrated that the amino-terminal domain of p16 outside the ankyrin repeats is dispensable for function. Schraml et al. (PMID:11159196) reported that this 24-bp deletion mutant was functionally normal for CDK4 binding, consistent with the deletion lying outside the ankyrin-repeat region. No well-established functional studies demonstrate a damaging effect for this variant. |
PMID:8668202
PMID:11159196
|
| PS4 | Not met | The prevalence of this variant in affected individuals does not reach statistical significance over population frequency. It has been observed in 1 of 87 high-risk Queensland melanoma families (PMID:10070944), 3 UK melanoma cases in a population-based screen (PMID:25780468), and is listed among CDKN2A mutations in the GenoMEL consortium (PMID:16905682). However, it is also present in gnomAD v4.1 at 153/1,606,464 alleles (AF=0.0095%) including one homozygote, and in gnomAD v2.1 at 36/265,240 alleles (AF=0.0136%). The population frequency is inconsistent with a high-penetrance pathogenic variant. |
PMID:10070944
PMID:25780468
PMID:16905682
gnomad_v2
gnomad_v4
|
| PS5 | N/A | PS5 applies to a different nucleotide change at the same codon as an established pathogenic missense variant. This variant is a 24-bp deletion spanning codons 4-11; PS5 semantics do not apply. |
|
| PM1 | Not met | This variant does not lie in a statistically significant mutational hotspot. The Cancer Hotspots database reports no significant hotspot at these residues, and the deletion spans residues 4-11 of the N-terminal region outside the ankyrin-repeat functional domain. |
|
| PM2 | Not met | While the allele frequency in gnomAD v2.1 (0.0136%) is below the 0.1% PM2 threshold, the variant is present at 153 alleles in gnomAD v4.1 with one observed homozygote. For a dominant, high-penetrance melanoma predisposition gene, the presence of a homozygote in a population database and a non-trivial allele count across two major databases argues against PM2 application. This criterion is not met when considering the totality of population frequency data. |
gnomad_v2
gnomad_v4
|
| PM4 | Not met | This is an in-frame 24-bp deletion removing 8 amino acids (p.Ala4_Pro11del). While in-frame deletions in non-repeat regions can meet PM4, functional evidence demonstrates that the N-terminal domain of p16 outside the ankyrin repeats is dispensable (PMID:8668202), and the specific 24-bp deletion mutant shows normal CDK4 binding (PMID:11159196). Additionally, the variant is present in population databases at a frequency incompatible with a pathogenic protein-length change in a dominant cancer gene. PM4 is not met. |
PMID:8668202
PMID:11159196
gnomad_v4
|
| PM5 | N/A | PM5 requires a different missense change at the same residue as a known pathogenic missense variant. This variant is a multi-residue deletion (codons 4-11); no same-residue missense comparator is definable. pm5_candidates.json confirms no eligible candidates could be harvested. |
pm5_candidates
|
| PM6 | Not assessed | No confirmed de novo data available for this variant in any of the reviewed sources. |
|
| PP1 | Not assessed | No co-segregation data are available for this variant. While the variant was observed in melanoma families (PMID:10070944, PMID:16905682), formal segregation analysis was not reported. |
|
| PP2 | N/A | PP2 applies to missense variants in genes with low rates of benign missense variation where missense is a common disease mechanism. This variant is an in-frame deletion, not a missense substitution. |
|
| PP3 | Not met | In silico tools provide no evidence of pathogenicity. SpliceAI predicts no significant splice impact (max delta score = 0.06). REVEL and BayesDel are not applicable to deletions. No HCI prior score is available for CDKN2A. No computational evidence supports a damaging effect. |
spliceai
|
| PP4 | Not assessed | No individual patient phenotype or clinical presentation data are available for this case. The variant has been observed in the context of melanoma family studies but no specific phenotype details for variant carriers are provided. |
|
| PP5 | Not met | No reputable source definitively reports this variant as pathogenic. ClinVar aggregate classification is Uncertain Significance (13 submitters VUS, 1 submitter Likely Benign). No expert panel has reviewed this variant. The variant was classified as 'pathogenic' in the research context of PMID:25780468 based on study-specific criteria, but this does not constitute a clinical-grade reputable source report. |
clinvar
|
| BA1 | Not met | The variant has a maximum allele frequency of 0.0136% in gnomAD v2.1 and 0.0095% in gnomAD v4.1, both well below the BA1 threshold of >1%. |
gnomad_v2
gnomad_v4
|
| BS1 | Not met | The variant has a maximum allele frequency of 0.0136% in gnomAD v2.1 and 0.0095% in gnomAD v4.1, both below the BS1 threshold of >0.3%. The grpmax FAF in v4.1 is 0.071% (Admixed American), still below 0.3%. |
gnomad_v2
gnomad_v4
|
| BS2 | Met | One homozygote for this variant is observed in gnomAD v4.1 (153 alleles total, 1 homozygous individual). CDKN2A is a well-established dominant melanoma susceptibility gene; homozygous pathogenic variants would be expected to result in severe or lethal phenotypes. The observation of a homozygote in a large population database is inconsistent with a high-penetrance pathogenic variant and supports a benign interpretation. |
gnomad_v4
|
| BS3 | Met | Well-established functional studies demonstrate no damaging effect on protein function. Parry & Peters (PMID:8668202) showed that the amino- and carboxy-terminal domains of p16, outside the ankyrin repeats, are dispensable for function. Schraml et al. (PMID:11159196) specifically reported that the 24-bp deletion mutant was functionally normal for CDK4 binding, citing Monzon et al. (1998). Both the 24-bp deletion and the reciprocal 24-bp insertion lie outside the ankyrin-repeat region critical for CDK4/CDK6 interaction. |
PMID:8668202
PMID:11159196
|
| BS4 | Not assessed | No co-segregation data or family studies with non-segregation evidence are available for this variant. The variant has been observed in melanoma families but formal segregation analysis has not been performed. |
|
| BP1 | N/A | BP1 applies to missense variants in genes where truncating variants are the primary disease mechanism. This variant is a deletion, not a missense substitution. Additionally, CDKN2A has both missense and truncating variants as established disease mechanisms for melanoma susceptibility. |
|
| BP2 | Not assessed | No data are available on whether this variant has been observed in trans with a known pathogenic CDKN2A variant. |
|
| BP3 | Met | The 24-bp deletion occurs within a repetitive sequence region at the 5' end of CDKN2A exon 1. Schraml et al. (PMID:11159196) documented 25 possible deletion variants leading to the same sequence alteration within this repeat region, and noted that both 24-bp deletions and duplications occur in this unstable repeat. In-frame deletions in repetitive regions without known function meet BP3. |
PMID:11159196
|
| BP4 | Met | SpliceAI predicts no significant splice impact (max delta score = 0.06). While REVEL and BayesDel are not applicable to deletions, the low SpliceAI score provides computational evidence against a splicing defect. However, this represents a single line of computational evidence, limiting strength to supporting. |
spliceai
|
| BP5 | Not assessed | No data are available on whether this variant has been observed in a case with an alternative molecular basis for disease. |
|
| BP6 | Not met | Only one clinical laboratory (Ambry Genetics) classifies this variant as Likely Benign, while 13 other clinical laboratories report it as Uncertain Significance. The lack of consensus among reputable clinical sources does not meet the threshold for BP6, which requires a reputable source to report the variant as benign. |
clinvar
|
| BP7 | N/A | BP7 applies to synonymous variants with no predicted splice impact. This variant is a 24-bp in-frame deletion, not a synonymous nucleotide substitution. |
|
Disclaimer:
The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.