Variant classification summary

NM_000314.8:c.324_354del

PTEN · NP_000305.3:p.(Asp109LeufsTer15) · NM_000314.8

GRCh37: chr10:89692838 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C · GRCh38: chr10:87933081 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C

Gene: PTEN Transcript: NM_000314.8

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.(Asp109LeufsTer15)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5 of PTEN, predicted to result in a premature termination codon (p.Asp109LeufsTer15) with nonsense-mediated decay. Per the PTEN VCEP PVS1 decision tree, this variant meets PVS1 at very strong strength as the frameshift is predicted to undergo NMD with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8.

2

The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada, meeting PM2_Supporting per the PTEN VCEP threshold of <0.00001 (0.001%) allele frequency.

3

Based on the PTEN VCEP combination rules (Rule1), the presence of one very strong pathogenic criterion (PVS1) is sufficient for a Pathogenic classification.

Final determination: Rule20 in the Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework is satisfied by the adjudicated criteria, so the variant is classified as Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5, predicted to result in a premature termination codon at position 123 (p.Asp109LeufsTer15). Per the PTEN VCEP PVS1 decision tree, the variant is a frameshift predicted to undergo nonsense-mediated decay with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8, warranting PVS1 at very strong strength.	vcep_pvs1_decisiontree_pten cspec pvs1_gene_context pvs1_variant_assessment
PS1	N/A	PS1 requires same amino acid change as a previously established pathogenic variant. This is a frameshift deletion producing a truncated protein, not a defined amino acid substitution comparable to an established pathogenic missense change.
PS2	Not met	No de novo observation reported for this variant in ClinVar, published literature, or case-level data.
PS3	Not met	No variant-specific functional assay data available. The PTEN VCEP PS3 rules specify splicing assay evidence (PS3_Strong), phosphatase activity per Mighell et al. 2018 (PS3_Moderate, missense only), or activity <50% of wild-type (PS3_Supporting). This frameshift variant is not represented in the Mighell et al. missense saturation mutagenesis dataset (mmc2.xlsx), and no RNA/mini-gene splicing assay has been reported for this variant.
PS4	Not met	No proband or case-control data available for this variant. The variant is absent from ClinVar and no published case observations were identified. PS4 per PTEN VCEP requires probands with a specificity score or a significantly increased prevalence in affected individuals.
PS5	N/A	PS5 is not a defined criterion within the ClinGen PTEN Expert Panel Specifications v3.2.0; the VCEP explicitly designates PP5 as Not Applicable for this VCEP, obviating the use of reputable source classifications.
PM1	Not met	The PTEN VCEP defines PM1-applicable catalytic motifs as residues 90-94 (WPD loop), 123-130 (P-loop), and 166-168 (TI-loop) (NP_000305.3). The deletion begins at codon 109, which lies outside these specified motifs.	cspec
PM2	Met	This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0, meeting the PTEN VCEP PM2_Supporting threshold of <0.00001 (0.001%) allele frequency.	gnomad_v2 gnomad_v4 gnomad_canada cspec
PM4	N/A	Per PTEN VCEP, PM4 applies to in-frame deletions/insertions impacting at least one catalytic motif residue, or to variants causing protein extension. This is an out-of-frame (frameshift) deletion.
PM5	N/A	PM5 requires a missense change at a residue where a different pathogenic missense change has been established. This is a 31 bp frameshift deletion, not a missense variant.
PM6	Not met	No assumed or confirmed de novo observations have been reported for this variant in any source.
PP1	Not met	No co-segregation data available for this variant in any family.
PP2	N/A	PP2 is specific to missense variants in a gene with a low rate of benign missense variation. This is a frameshift deletion.
PP3	N/A	PP3 per PTEN VCEP applies to splice-altering variants (SpliceAI + VarSeak concordance) or missense variants (REVEL >0.7). This is a frameshift deletion with SpliceAI max delta score 0.03 (no significant splice impact) and no applicable REVEL score.	spliceai
PP4	N/A	Not applicable per PTEN VCEP; phenotype specificity has been incorporated into the PS4 rule specifications.	cspec
PP5	N/A	Not applicable per PTEN VCEP; this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee.	cspec
BA1	Not met	The variant is absent from gnomAD populations; does not meet the PTEN VCEP BA1 threshold of filtering allele frequency >0.00056 (0.056%).	gnomad_v2 gnomad_v4 gnomad_canada
BS1	Not met	The variant is absent from gnomAD populations; does not meet the PTEN VCEP BS1 threshold (filtering allele frequency 0.000043-0.00056 for BS1_Strong or 0.0000043-0.000043 for BS1_Supporting).	gnomad_v2 gnomad_v4 gnomad_canada
BS2	Not met	No observation of this variant in the homozygous state in a healthy or PHTS-unaffected individual has been reported.	gnomad_v2 gnomad_v4
BS3	Not met	No well-established functional studies demonstrating no damaging effect are available for this variant. The PTEN VCEP BS3 rules specify splicing assays for intronic/synonymous variants or phosphatase activity >0 per Mighell et al. (missense only). This frameshift variant has no applicable functional benign evidence.
BS4	Not met	No segregation data demonstrating lack of segregation in affected family members are available for this variant.
BP1	N/A	Not applicable per PTEN VCEP; this rule (missense variant in gene where primarily truncating variants cause disease) is not applicable to PTEN.	cspec
BP2	Not met	No observation of this variant in trans with a pathogenic/likely pathogenic PTEN variant, and no observations in cis or phase-unknown with different P/LP PTEN variants.
BP3	N/A	Not applicable per PTEN VCEP; this rule (in-frame deletions/insertions in a repetitive region without known function) is not applicable to PTEN.	cspec
BP4	N/A	BP4 per PTEN VCEP is specified for synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact. This is a coding frameshift deletion and falls outside the intended scope of this criterion.
BP5	Not met	No observation of this variant in a case with an alternate molecular basis for disease. Per PTEN VCEP, at least two such cases are required.
BP6	N/A	Not applicable per PTEN VCEP; this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee.	cspec
BP7	N/A	BP7 applies to synonymous or intronic variants at or beyond +7/-21 with no predicted splice impact. This is a coding frameshift deletion.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.