LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-07-11
Case ID: NM_001259.8_c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC_20260711_030958
Framework: ACMG/AMP 2015
Variant classification summary

NM_001259.8:c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC

CDK6  · NP_001250.1:p.(Ala294SerfsTer31)  · NM_001259.8
GRCh37: chr7:92244480 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA  ·  GRCh38: chr7:92615166 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA
Gene: CDK6 Transcript: NM_001259.8
Final call
VUS
PVS1 moderate PM2 moderate
All criteria require review: For research and educational purposes only.
Gene
CDK6
Transcript
NM_001259.8
Protein
NP_001250.1:p.(Ala294SerfsTer31)
gnomAD AF
ClinVar
OncoKB
Unknown Oncogenic Effect
Interpretation summary
Generated evidence synthesis
1
PVS1 at moderate strength: NM_001259.8:c.880_955delins is a frameshift variant predicted to result in p.(Ala294SerfsTer31), truncating the C-terminal kinase domain of CDK6. CDK6 loss of function is an established germline disease mechanism. Nonsense-mediated decay is not predicted because the variant is in the last exon (8/8) and the premature termination codon (codon 325) lies within 50 nucleotides of the final exon-exon junction. Under PMC6185798 guidance for truncating variants escaping NMD that affect a critical functional domain, PVS1 is downgraded to moderate.
2
PM2 at moderate strength: The variant is absent from gnomAD v2.1 (141,456 individuals), gnomAD v4.1 (807,162 individuals), and gnomAD-Canada v1.0 (HostSeq genomes). No population frequency data supports benign standing variation.
3
The variant is absent from ClinVar and COSMIC. No publications, functional data, or family segregation data were identified for this specific variant. Per the generic ACMG/AMP 2015 classification framework (PMID:25741868), PVS1 at moderate plus PM2 at moderate yields two moderate pathogenic criteria, which does not reach the threshold for Likely Pathogenic (requires ≥3 moderate or 1 strong + 1-2 moderate). This variant is classified as a Variant of Uncertain Significance (VUS).
Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 Met Frameshift variant NM_001259.8:c.880_955delins predicted to result in p.(Ala294SerfsTer31). CDK6 loss of function is an established germline disease mechanism. Under PMC6185798, the variant is in the last exon (8/8) and the premature termination codon at codon 325 is within 50 nucleotides of the final exon-exon junction, so nonsense-mediated decay is not predicted. The truncation removes the C-terminal portion of the kinase domain (residues 294-326) and replaces it with 31 novel amino acids, partially disrupting a well-characterized functional domain. Downgraded from very strong to moderate per PMC6185798 guidance for truncating variants in the last exon that affect a critical functional region but are not expected to undergo NMD.
pvs1_generic_framework pvs1_gene_context pvs1_variant_assessment
PS1 N/A Frameshift variant; PS1 applies only when the variant results in the same amino acid change as a known pathogenic variant.
PS2 Not assessed No de novo data available; parental testing was not reported in case materials.
PS3 Not assessed No functional studies identified for this specific variant or for a systematically characterized range that includes codon 294 in CDK6. The literature pass returned zero PMIDs.
PS4 Not assessed No case-control or case-series data available for this variant. The variant is absent from ClinVar and no affected individuals have been reported.
PS5 N/A Frameshift variant; PS5 requires the same amino acid change as an established pathogenic variant and is not applicable to frameshift alterations.
PM1 Not met The variant does not lie within a statistically significant mutational hotspot (cancerhotspots.org negative). Although the truncation partially disrupts the C-terminal kinase domain, the affected region (residues 294-326) is the distal C-terminal tail and the last few residues of the kinase domain. The core catalytic residues of the kinase domain are not directly affected by this truncation. The variant does not remove or substantially disrupt a well-characterized critical functional domain that meets the PM1 domain-level threshold for this gene.
PM2 Met This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0 (HostSeq genomes). Under generic ACMG/AMP criteria, absence from large population databases supports PM2 at moderate strength (allele frequency below 0.1% threshold).
gnomad_v2 gnomad_v4 gnomad_canada
PM4 N/A Frameshift variant; PM4 applies to in-frame deletions/insertions in non-repeat regions and stop-loss variants, not to frameshift alterations.
PM5 N/A Frameshift variant; PM5 requires a novel missense change at a residue where a different missense change has been established as pathogenic. The PM5 candidate pipeline was unable to identify same-residue missense comparators for this frameshift variant.
PM6 Not assessed No de novo data available; no parental testing results were provided in case materials.
PP1 Not assessed No segregation data available for this variant.
PP2 N/A Frameshift variant; PP2 applies to missense variants in genes with a low rate of benign missense variation where missense variants are a common disease mechanism.
PP3 N/A REVEL, BayesDel, and SpliceAI scores are not available for this frameshift variant. Computational in silico predictors are not validated for frameshift variants and should not be used for PP3/BP4 assessment.
PP4 Not assessed No clinical phenotype or family history data were provided in the case materials to assess specificity for a CDK6-related disorder.
PP5 Not met This variant is absent from ClinVar. No reputable source has reported this variant as pathogenic.
clinvar
BA1 Not met This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada. The BA1 threshold (allele frequency >1%) is not met.
gnomad_v2 gnomad_v4
BS1 Not met This variant is absent from population databases. The BS1 threshold (allele frequency >0.3% for non-VCEP assessment) is not met.
gnomad_v2 gnomad_v4
BS2 Not assessed No data available on observation of this variant in healthy adult individuals for a fully penetrant disorder.
BS3 Not assessed No functional studies identified for this variant demonstrating no damaging effect on protein function.
BS4 Not assessed No segregation data available to evaluate lack of segregation in affected family members.
BP1 N/A Frameshift variant; BP1 applies to missense variants in genes where primarily truncating variants cause disease.
BP2 Not assessed No data available on observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder.
BP3 N/A Frameshift variant; BP3 applies to in-frame deletions or insertions in repetitive regions without known function.
BP4 N/A Frameshift variant; REVEL, BayesDel, and SpliceAI are not applicable to frameshift variants and computational predictors are not validated for this variant class.
BP5 Not assessed No data available on whether the proband carries an alternative molecular basis for disease.
BP6 Not met This variant is absent from ClinVar. No reputable source has reported this variant as benign.
clinvar
BP7 N/A Frameshift variant; BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence.
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.