NM_014641.2:c.619_642del

MDC1 · NP_055456.2:p.(Gly207_Phe214del) · NM_014641.2

GRCh37: chr6:30681076 TGAAGGCAAAAGGCGGCCCAAGGCC>T · GRCh38: chr6:30713299 TGAAGGCAAAAGGCGGCCCAAGGCC>T

Gene: MDC1 Transcript: NM_014641.2

Final call

VUS

PM4 supporting BP4 supporting benign

Variant details

Gene

MDC1

Transcript

NM_014641.2

Protein

NP_055456.2:p.(Gly207_Phe214del)

gnomAD AF

ClinVar

Benign

OncoKB

Unknown Oncogenic Effect

Classification rationale

Interpretation summary

Generated evidence synthesis

NM_014641.2:c.619_642del (p.Gly207_Phe214del) is an in-frame deletion removing 8 amino acids in MDC1.

PM4 (supporting) is met: this is a 24bp in-frame deletion causing a protein length change. The deleted segment does not appear to lie within a repetitive region.

BP4 (supporting benign) is met: SpliceAI predicts no splice impact (max delta score = 0.00).

This variant does not meet PVS1, PS1–PS5, PM1–PM3, PM5–PM6, PP1–PP5, BA1, BS1–BS4, BP1–BP3, or BP5–BP7 due to absence of supporting evidence or inapplicability to this variant type.

ClinVar classifies this variant as Benign (1 clinical laboratory, single submitter), but the review status does not meet the 3-star expert panel threshold for BP6.

This variant has been observed in somatic cancers (COSMIC, n=3), but somatic occurrence does not independently establish germline pathogenicity.

Overall classification: Uncertain Significance (VUS). One supporting pathogenic criterion (PM4) is balanced by one supporting benign criterion (BP4), yielding conflicting evidence insufficient for a likely pathogenic or likely benign classification per generic ACMG/AMP 2015 rules.

Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not met	NM_014641.2:c.619_642del is an in-frame deletion removing 8 amino acids (Gly207_Phe214del). It does not fall into the ClinGen SVI PVS1 null-variant buckets (nonsense, frameshift, or canonical ±1,2 splice consensus) per PMC6185798. The variant does not trigger nonsense-mediated decay and is not a loss-of-function null variant under the PVS1 decision tree.	pvs1_generic_framework pvs1_gene_context pvs1_variant_assessment
PS1	N/A	PS1 requires a nucleotide change predicted to produce the same amino acid change as an established pathogenic variant. This is an in-frame deletion, not a nucleotide substitution producing a missense change.
PS2	Not met	No de novo observations are available for this variant. No publications or clinical reports document a de novo occurrence of NM_014641.2:c.619_642del.
PS3	Not met	No variant-specific functional data exist for NM_014641.2:c.619_642del. OncoKB reports Unknown Oncogenic Effect with no reviewed functional evidence. No publications identified for this variant.	oncokb
PS4	Not met	No case-control or statistical evidence demonstrating enrichment of this variant in affected individuals versus controls is available.
PS5	Not met	No publications or clinical reports from independent research groups document this variant in unrelated patients with the same phenotype. No PMIDs were identified across evidence sources.
PM1	Not met	The deleted region (aa 207-214) does not lie in a statistically significant mutational hotspot per cancerhotspots.org. No publication specifically characterizes this exact 8-amino-acid segment as a critical well-established functional domain. The broader N-terminal region of MDC1 contains SDT/TQXF motifs involved in ATM-mediated DNA damage signaling, but the specific deleted segment has not been individually characterized as a functional domain in the literature.
PM2	Not met	The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada. However, allele counts and allele numbers are null (not zero), indicating that this 24bp in-frame deletion cannot be reliably genotyped by short-read sequencing pipelines. The absence from gnomAD is a technological limitation rather than evidence of variant rarity, and a reliable allele frequency cannot be computed.	gnomad_v2 gnomad_v4 gnomad_canada
PM3	N/A	Skipped per case instructions.
PM4	Met	NM_014641.2:c.619_642del is a 24bp in-frame deletion removing 8 amino acids (p.Gly207_Phe214del), causing a protein length change. The deleted segment does not appear to be a simple tandem repeat region based on available sequence analysis. However, the functional significance of this specific 8-amino-acid deletion in a 2089-amino-acid protein is uncertain, warranting supporting rather than moderate strength.
PM5	N/A	PM5 requires a different missense change at the same residue that is pathogenic. This is an in-frame deletion, not a missense variant. The PM5 candidates harvest confirms no eligible same-residue comparator variants exist.	pm5_candidates
PM6	Not met	No de novo observations are available for this variant. No publications document a de novo occurrence of NM_014641.2:c.619_642del.
PP1	Not met	No segregation data are available for this variant. No family studies have been published.
PP2	N/A	PP2 applies to missense variants in genes with a low rate of benign missense variation. This is an in-frame deletion, not a missense variant.
PP3	Not met	No in silico prediction tools support a pathogenic effect. REVEL and BayesDel scores are not available for this variant type (in-frame deletion). SpliceAI predicts no splice impact (max delta score = 0.00), which is expected for a coding deletion and does not suggest pathogenicity.	spliceai
PP4	Not met	No patient phenotype or family history data are available for this case.
PP5	Not met	ClinVar classifies this variant as Benign, not Pathogenic. PP5 requires a reputable source to report the variant as pathogenic.	clinvar
BA1	Not met	The variant is absent from gnomAD (null allele counts). There is no evidence of an allele frequency >1% in any population database.	gnomad_v2 gnomad_v4
BS1	Not met	The variant is absent from gnomAD. There is no evidence of an allele frequency >0.3% in any population database.	gnomad_v2 gnomad_v4
BS2	Not met	No data are available regarding observation of this variant in healthy individuals, either in the homozygous state or in trans with a pathogenic variant.
BS3	Not met	No well-established functional studies demonstrate no deleterious effect for this variant. No functional data of any kind exist for NM_014641.2:c.619_642del.
BS4	Not met	No segregation data are available to demonstrate lack of cosegregation with disease in affected family members.
BP1	N/A	BP1 applies to missense variants in genes where primarily truncating variants cause disease. This is an in-frame deletion, not a missense variant.
BP2	Not met	No data are available regarding observation of this variant in trans with a pathogenic variant or in cis with a pathogenic variant.
BP3	Not met	BP3 applies to in-frame deletions in repetitive regions without known function. The deleted segment (aa 207-214: Gly207_Phe214del) is in the N-terminal region of MDC1 that contains SDT/TQXF motifs involved in ATM-mediated DNA damage signaling — a functionally characterized region. There is insufficient evidence to classify this 8-amino-acid segment as a repetitive region without known function.
BP4	Met	SpliceAI predicts no splice impact for this variant (max delta score = 0.00 across all splice categories). Although this is expected for an in-frame exonic deletion and represents a single computational line of evidence, it is consistent with no splicing aberration. REVEL and BayesDel are not applicable to this variant type.	spliceai
BP5	Not met	No data are available documenting this variant in a case with an alternate molecular basis for disease.
BP6	Not met	This variant is classified as Benign in ClinVar (ClinVar ID 2656343, 1 clinical laboratory). However, the review status is 'criteria provided, single submitter' (1-star), which does not meet the 3-star expert panel threshold required for supporting benign evidence under the adjudication framework.	clinvar
BP7	N/A	BP7 applies to silent (synonymous) variants with no predicted splice impact. This is an in-frame deletion removing 8 amino acids, not a silent variant.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.