LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Variant classification summary
NM_006015.5:c.2378_2396del
ARID1A
· NP_006006.3:p.(Met793ArgfsTer34)
· NM_006015.5
GRCh37: chr1:27088765 TCCATGGGGAGCTATGGTCC>T
·
GRCh38: chr1:26762274 TCCATGGGGAGCTATGGTCC>T
Gene:
ARID1A
Transcript:
NM_006015.5
Final call
Pathogenic
PVS1 very strong
PM1 moderate
PM2 supporting
Variant details
Gene
ARID1A
Transcript
NM_006015.5
Protein
NP_006006.3:p.(Met793ArgfsTer34)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34) is a frameshift deletion predicted to undergo nonsense-mediated decay in ARID1A, a gene with an established loss-of-function disease mechanism associated with BAFopathies including Coffin-Siris syndrome. PVS1 is applied at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).
2
The variant truncates the ARID1A protein at codon 793, removing approximately 65% of the coding sequence including all C-terminal functional domains critical for SWI/SNF chromatin remodeling complex assembly and tumor suppression. PM1 is applied at moderate strength.
3
The variant is absent from all population databases including gnomAD v2.1, v4.1, and gnomAD-Canada. PM2 is applied at supporting strength.
4
No variant-specific functional studies, clinical case reports, segregation data, de novo observations, or ClinVar classifications are available for this variant. All reviewed publications discuss ARID1A at the gene level and do not mention NM_006015.5:c.2378_2396del.
5
Applying the ACMG/AMP 2015 combination rules: PVS1 (very strong) + PM1 (moderate) + PM2 (supporting) meets the pathogenic threshold (1 Very Strong + 1 Moderate + ≥1 Supporting). The variant is classified as Pathogenic.
Final determination:
Generic ACMG/AMP 2015 fallback rules support a Pathogenic classification based on the observed combination of very strong, strong, moderate, and supporting pathogenic criteria.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
| Criterion | Status | Rationale | Evidence used |
|---|---|---|---|
| PVS1 | Met | NM_006015.5:c.2378_2396del is a frameshift deletion predicted to result in a premature termination codon (p.Met793ArgfsTer34) in exon 7 of 20. The variant is predicted to undergo nonsense-mediated decay. ARID1A has an established loss-of-function disease mechanism supported by germline disease context literature (BAFopathies including Coffin-Siris syndrome, fetal hydrocephalus), and the gene is eligible for generic PVS1 assessment under PMC6185798. A newer transcript version NM_006015.6 exists but does not alter the null-effect assessment. |
pvs1_generic_framework
pvs1_gene_context
pvs1_variant_assessment
|
| PS1 | N/A | PS1 applies to nucleotide-level changes at the same position. This is a 19-bp deletion, not a single-nucleotide change amenable to PS1 comparison. |
|
| PS2 | Not met | No de novo observation has been reported for NM_006015.5:c.2378_2396del. The variant is absent from ClinVar and no publication reports a de novo event involving this variant. |
|
| PS3 | Not met | No variant-specific functional studies have been performed for NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34). Four publications retrieved via OncoKB discuss ARID1A functional characterization at the gene level (tumor suppressor, SWI/SNF chromatin remodeling), but none tested or reported this exact variant. Domain-level inference from gene-level studies does not satisfy PS3's requirement for variant-specific or systematically characterized range-level functional evidence. |
|
| PS4 | Not met | NM_006015.5:c.2378_2396del has not been reported in affected individuals. The variant is absent from ClinVar, COSMIC, and all reviewed publications. |
|
| PS5 | N/A | PS5 is an obsolete criterion and was replaced by PM5 (stronger weight) and PS2 (de novo) in updated ACMG/AMP frameworks. |
|
| PM1 | Met | NM_006015.5:c.2378_2396del introduces a frameshift at codon 793 (p.Met793ArgfsTer34) that truncates the ARID1A protein, removing approximately 65% of the coding sequence including all C-terminal functional domains. ARID1A is a well-characterized tumor suppressor and core component of the SWI/SNF chromatin remodeling complex (PMID:21900401, PMID:22009941). The truncation removes regions essential for SWI/SNF complex assembly and chromatin remodeling activity. The variant is absent from population databases, satisfying the requirement of no benign variation in the region. |
PMID:21900401
PMID:22009941
gnomad_v2
gnomad_v4
|
| PM2 | Met | NM_006015.5:c.2378_2396del is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes), and gnomAD-Canada v1.0 (genomes). Under non-VCEP generic ACMG/AMP, PM2 is applied at supporting strength for variants with allele frequency below 0.1% in population databases. |
gnomad_v2
gnomad_v4
gnomad_canada
|
| PM3 | N/A | Skipped per user instruction. |
|
| PM4 | N/A | PM4 applies to in-frame deletions/insertions in non-repeat regions or stop-loss variants. NM_006015.5:c.2378_2396del is an out-of-frame (frameshift) deletion, not an in-frame change. PM4 does not apply to frameshift variants. |
|
| PM5 | N/A | PM5 applies to novel missense changes at the same amino acid residue as a known pathogenic missense variant. NM_006015.5:c.2378_2396del is a frameshift deletion, not a missense change, and has no comparable same-residue missense variants. The automatic PM5 candidate harvest confirmed this is not eligible for classic PM5 search. |
pm5_candidates
|
| PM6 | Not met | No de novo observation has been reported for NM_006015.5:c.2378_2396del. PM6 requires confirmed de novo status (both maternity and paternity confirmed). |
|
| PP1 | Not met | No segregation data are available for NM_006015.5:c.2378_2396del. No family studies have been reported for this variant in any publication reviewed. |
|
| PP2 | N/A | PP2 applies to missense variants in genes with a low rate of benign missense variation. NM_006015.5:c.2378_2396del is a frameshift deletion, not a missense variant. |
|
| PP3 | Not met | SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16, well below the 0.2 threshold). REVEL and BayesDel scores are not applicable to deletion variants. No in silico evidence supports a damaging effect. |
spliceai
|
| PP4 | Not met | No patient phenotype or family history data are available for this variant. PP4 requires a phenotype highly specific for the gene/disease with a single genetic etiology. |
|
| PP5 | Not met | NM_006015.5:c.2378_2396del is absent from ClinVar. PP5 requires a reputable source (ClinVar 3-star expert panel) to have classified the variant as pathogenic. No ClinVar entry exists for this variant. |
clinvar
|
| BA1 | Not met | NM_006015.5:c.2378_2396del is absent from all population databases (gnomAD v2.1, v4.1, Canada). BA1 requires an allele frequency above 1% in population databases. |
gnomad_v2
gnomad_v4
|
| BS1 | Not met | NM_006015.5:c.2378_2396del is absent from all population databases. BS1 requires an allele frequency above 0.3% (non-VCEP threshold). |
gnomad_v2
gnomad_v4
|
| BS2 | Not met | No observation of this variant in healthy adult individuals has been reported. BS2 requires documented observation in a healthy adult for a disorder with full penetrance expected at an early age. |
|
| BS3 | Not met | No variant-specific functional studies demonstrating a benign effect have been reported for NM_006015.5:c.2378_2396del. The four publications reviewed discuss ARID1A as a tumor suppressor with loss-of-function as the pathogenic mechanism, which is consistent with a deleterious effect of this truncating variant, not a benign one. |
|
| BS4 | Not met | No segregation data are available for NM_006015.5:c.2378_2396del. BS4 requires lack of segregation in affected family members. |
|
| BP1 | N/A | BP1 applies to missense variants in genes for which primarily truncating variants are known to cause disease. NM_006015.5:c.2378_2396del is itself a truncating (frameshift) variant, not a missense variant. |
|
| BP2 | Not met | No data on co-occurrence (in trans or in cis) with a pathogenic variant are available for NM_006015.5:c.2378_2396del. |
|
| BP3 | N/A | BP3 applies to in-frame deletions/insertions in repetitive regions without known function. NM_006015.5:c.2378_2396del is an out-of-frame (frameshift) deletion, not an in-frame change. |
|
| BP4 | Not met | SpliceAI predicts no significant splice impact (max delta = 0.16), but multiple independent lines of computational evidence are required for BP4. REVEL and BayesDel are not applicable to deletion variants. A single in silico predictor with a low score is insufficient to meet BP4's requirement for multiple lines of benign evidence. |
spliceai
|
| BP5 | Not met | No data are available showing this variant in a case with an alternate molecular basis for disease. |
|
| BP6 | Not met | NM_006015.5:c.2378_2396del is absent from ClinVar. BP6 requires a reputable source to have classified the variant as benign. No ClinVar entry exists for this variant. |
clinvar
|
| BP7 | N/A | BP7 applies to synonymous variants with no predicted splice impact and low nucleotide conservation. NM_006015.5:c.2378_2396del is a frameshift deletion, not a synonymous variant. |
|
Disclaimer:
The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.