LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-07-28
Case ID: NM_000222.2_c.1679_1738delinsATG_20260728_172008
Framework: ACMG/AMP 2015
Variant classification summary

NM_000222.2:c.1679_1738delinsATG

KIT  · NP_000213.1:p.(Val560_His580delinsAspAsp)  · NM_000222.2
GRCh37: chr4:55593613 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG  ·  GRCh38: chr4:54727447 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG
Gene: KIT Transcript: NM_000222.2
Final call
VUS
PM1 moderate PM2 supporting PM4 supporting
All criteria require review: For research and educational purposes only.
Variant details
Gene
KIT
Transcript
NM_000222.2
Protein
NP_000213.1:p.(Val560_His580delinsAspAsp)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_000222.2:c.1679_1738delinsATG is an in-frame deletion-insertion in KIT exon 11 resulting in p.Val560_His580delinsAspAsp, which removes a 21-amino-acid segment of the juxtamembrane autoinhibitory domain. PM1 (moderate) is met: the juxtamembrane domain is a well-characterized critical functional domain, and its disruption causes ligand-independent constitutive kinase activation.
2
PM2 (supporting) is met: the variant is absent from gnomAD v2.1 and v4.1 population databases.
3
PM4 (supporting) is met: a non-repeat in-frame deletion of 21 amino acids in a functionally critical domain.
4
PVS1 is not applicable: this is an in-frame deletion-insertion, not a null variant eligible under ClinGen PVS1 decision tree criteria (PMC6185798).
5
PS3 is not met: no variant-specific functional study directly testing p.Val560_His580delinsAspAsp was found in the provided literature. The gain-of-function mechanism of KIT exon 11 deletions is well-established at the domain level and contributes to PM1, but does not independently satisfy PS3 variant-specific functional evidence requirements.
6
PS1, PS5, and PM5 are not applicable to this indel variant type.
7
No benign criteria are met. BS3 is specifically not met because functional evidence supports a gain-of-function pathogenic mechanism.
8
Total evidence: PM1 (moderate) + PM2 (supporting) + PM4 (supporting). This combination is consistent with a classification of Likely Pathogenic under ACMG/AMP 2015 combination rules (2 moderate + supporting evidence).
Final determination: Generic ACMG/AMP 2015 fallback rules do not meet benign, likely benign, likely pathogenic, or pathogenic combination thresholds, so the variant is classified as Variant of Uncertain Significance.
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 N/A In-frame deletion-insertion (NP_000213.1:p.Val560_His580delinsAspAsp) is not a null variant. The ClinGen SVI PVS1 decision tree (PMC6185798) excludes this variant from the default null-variant buckets (nonsense, frameshift, or canonical ±1,2 splice consensus). PVS1 is not applicable to in-frame deletions.
pvs1_generic_framework
PS1 N/A PS1 requires a different amino acid change at the same residue as a known pathogenic missense variant. This variant is an in-frame deletion-insertion, not a missense change, and PS1 semantics cannot be applied to indels.
PS2 Not met No de novo observation was identified for NM_000222.2:c.1679_1738delinsATG in any of the reviewed literature or database evidence.
PS3 Not met No variant-specific functional study directly testing NM_000222.2:c.1679_1738delinsATG (p.Val560_His580delinsAspAsp) was identified in the provided literature. The reviewed papers describe KIT exon 11 in-frame deletions as a class with gain-of-function mechanism via juxtamembrane autoinhibition disruption, but this is domain-level characterization (PM1 territory), not variant-specific or systematic-range functional data meeting PS3 requirements. OncoKB curation classifies this variant as Likely Oncogenic/Likely Gain-of-function, but the primary functional data supporting this annotation was not available for review.
oncokb
PS4 Not met This variant is absent from ClinVar and no case-control prevalence data in affected individuals versus controls was identified.
clinvar
PS5 N/A PS5 requires a different amino acid change at the same residue as a known pathogenic missense variant. This is an indel, not a missense change, and PS5 semantics cannot be applied.
PM1 Met This variant removes amino acids 560-580 of the KIT juxtamembrane domain (exon 11), a well-characterized critical autoinhibitory domain. The juxtamembrane domain functions to inhibit receptor dimerization in the absence of ligand; in-frame deletions within this domain disrupt autoinhibition, causing ligand-independent constitutive kinase activation. Located in a statistically significant cancer hotspot (cancerhotspots.org).
PMID:15365079
PM2 Met This variant is absent from gnomAD v2.1 (exomes) and gnomAD v4.1 (exomes/genomes), indicating it is extremely rare or absent in the general population (allele frequency <0.1% threshold for PM2).
gnomad_v2 gnomad_v4
PM4 Met This in-frame deletion-insertion removes 21 amino acids (Val560 through His580) and replaces them with 2 amino acids (Asp-Asp), representing a net loss of 19 amino acids in a non-repeat region. The protein length change occurs within the functionally critical KIT juxtamembrane autoinhibitory domain.
PMID:15365079
PM5 N/A This is an in-frame deletion-insertion, not a missense variant. Classic PM5 requires a different missense change at the same residue as a known pathogenic missense variant. PM5 candidate harvesting was unable to resolve classic same-residue semantics for this variant type.
pm5_candidates
PM6 Not met No de novo observation was identified for this variant in any of the reviewed literature.
PP1 Not met No segregation data is available for this variant. No family studies were identified in the reviewed literature.
PP2 Not met PP2 applies to genes where missense variants are a common mechanism of disease and the variant is a missense change. This is an in-frame indel in KIT, a gene where gain-of-function (not loss-of-function) is the primary disease mechanism, and the gene is not established as one where missense variants are a predominant pathogenic mechanism in a PP2-compatible framework.
PP3 Not met In silico predictors (REVEL, BayesDel) are not available for this indel variant. SpliceAI predicts no significant splice impact (max delta score = 0.01), which does not support a deleterious splicing effect. HCI prior score is not available for this gene. No computational evidence supports a deleterious effect.
spliceai
PP4 Not met No specific phenotype data was identified for this variant. The variant is absent from ClinVar, and no case reports describing the phenotype of individuals harboring this specific variant were found in the reviewed literature.
PP5 N/A This variant is absent from ClinVar. No reputable source (≥3-star expert panel) classifies this variant as pathogenic.
clinvar
BA1 Not met This variant is absent from gnomAD v2.1 and v4.1. Allele frequency of 0 is well below the BA1 threshold (>1%).
gnomad_v2 gnomad_v4
BS1 Not met This variant is absent from gnomAD v2.1 and v4.1. Allele frequency of 0 is below the BS1 threshold (>0.3%).
gnomad_v2 gnomad_v4
BS2 Not met No evidence of observation in healthy adult individuals was identified for this variant.
BS3 Not met Well-established functional studies show KIT exon 11 in-frame deletions are gain-of-function (activating) mutations that disrupt juxtamembrane autoinhibition and cause constitutive kinase activation. This evidence supports pathogenicity, not a benign interpretation.
PMID:15365079 oncokb
BS4 Not met No segregation data suggesting lack of segregation with disease was identified.
BP1 Not met BP1 applies to missense variants in genes where truncating variants are the primary mechanism of disease. This is an in-frame deletion-insertion, not a missense variant, and KIT disease mechanism is gain-of-function, not loss-of-function via truncation.
BP2 Not met No observation of this variant in trans with a known pathogenic variant was identified.
BP3 Not met BP3 applies to silent and intronic variants without predicted splicing impact. This is an in-frame deletion-insertion in the coding region of a critical functional domain.
BP4 Not met While SpliceAI predicts no splicing impact (max delta = 0.01), this is an in-frame deletion with well-established functional consequences via disruption of the juxtamembrane autoinhibitory domain. The absence of splicing impact does not support a benign interpretation for a variant with a known gain-of-function mechanism at the protein level. REVEL and BayesDel are not available for indels.
spliceai
BP5 Not met No evidence was identified that this variant is found in a case with an alternative molecular basis for disease.
BP6 N/A This variant is absent from ClinVar. No reputable source classifies it as benign.
clinvar
BP7 Not met BP7 applies to synonymous (silent) variants with no predicted splicing impact. This is an in-frame deletion-insertion, not a synonymous variant. SpliceAI predicts no splicing impact (max delta = 0.01), but BP7 criteria are restricted to silent variants.
spliceai
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.