LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Generated: 2026-07-29
Case ID: NM_000077.4_c.52_83del_20260729_012156
Framework: ACMG/AMP 2015
Variant classification summary

CDKN2A  · NP_000068.1:p.(Thr18AlafsTer15)  · NM_000077.4
GRCh37: chr9:21974743 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C  ·  GRCh38: chr9:21974744 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C
Gene: CDKN2A Transcript: NM_000077.4
Final call
All criteria require review: For research and educational purposes only.
Variant details
Gene
CDKN2A
Transcript
NM_000077.4
Protein
NP_000068.1:p.(Thr18AlafsTer15)
gnomAD AF
ClinVar
Likely oncogenic
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 of CDKN2A predicted to produce a truncated protein (p.Thr18AlafsTer15) that removes all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A, meeting PVS1 at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).
2
The variant is absent from gnomAD v2.1, v4.1, and Canada population databases, satisfying PM2 at moderate strength.
3
The variant completely removes the well-characterized ankyrin-repeat and CDK4/6 binding domains of p16INK4A, meeting PM1 at moderate strength. Published functional studies demonstrate that N-terminal deletions and premature termination mutants of p16INK4A abolish CDK4/6 binding and kinase inhibitory activity.
4
No functional study directly tested NM_000077.4:c.52_83del; PS3 is not met. Existing truncation data from PMID:8603820 (deletion constructs) and PMID:8668202 (premature termination mutants) provide domain-level evidence applied under PM1 rather than variant-specific PS3.
5
ClinVar classifies this variant as 'Likely oncogenic' (somatic, 1-star single submitter) under variation ID 4539651. This somatic classification and review status do not satisfy PP5 for germline pathogenicity assessment.
6
This variant has been reported in somatic cancers (COSMIC COSV58693372, n = 9) and is classified as Likely Oncogenic/Likely Loss-of-function by OncoKB, consistent with a deleterious biological effect.
Final determination:
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
Criterion Status Rationale Evidence used
PVS1 Met NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 predicted to produce a premature termination codon at position 32 (p.Thr18AlafsTer15), removing all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A. Under PMC6185798, frameshift variants in genes with an established loss-of-function disease mechanism meet PVS1 at very strong strength. CDKN2A loss of function is a well-established germline disease mechanism for familial atypical multiple mole melanoma (FAMMM) and pancreatic ductal adenocarcinoma susceptibility. NMD is predicted as the premature termination codon resides >50 nucleotides upstream of the last exon–exon junction.
pvs1_generic_framework pvs1_gene_context pvs1_variant_assessment
PS1 N/A PS1 applies to a nucleotide change producing the same amino acid change as an established pathogenic variant. This variant is a 32 bp deletion causing a frameshift, not a single nucleotide substitution.
PS2 Not met No de novo observation of NM_000077.4:c.52_83del has been reported in any reviewed publication or database.
PS3 Not met No functional study directly tested NM_000077.4:c.52_83del. Published functional data on other CDKN2A truncation variants (PMID:8668202, PMID:8603820) demonstrates that N-terminal premature termination mutants abolish CDK4/6 binding and kinase inhibitory activity; however, this constitutes domain-level evidence appropriate for PM1 rather than variant-specific PS3. A missense variant at the same codon (p.Thr18Pro) was tested in PMID:35001868 and found functionally deleterious in a cell proliferation assay, but this is a different variant type and does not meet the threshold for PS3. Under the PS3 calibration rules, domain-level inference from sparse residue testing does not qualify for any PS3 strength.
PS4 Not met No case-control data comparing the prevalence of NM_000077.4:c.52_83del in affected individuals versus controls has been reported. The ClinVar entry (4539651) is a somatic 'Likely oncogenic' classification without germline case observations.
PS5 N/A PS5 is not a criterion in the standard ACMG/AMP 2015 classification framework used for this assessment (generic_acmg fallback). No VCEP/CSPEC framework defines PS5 for CDKN2A.
PM1 Met NM_000077.4:c.52_83del creates a premature termination at codon 32, completely removing all four ankyrin-repeat domains (aa ~11-43, ~44-76, ~77-110, ~111-142) and the CDK4/6 binding region of p16INK4A, which are well-characterized functional domains critical for tumor suppressor activity. Under the PM1 domain-level rule, variants that remove or disrupt a critical functional domain characterized in the literature satisfy PM1.
PMID:8603820 PMID:8668202
PM2 Met NM_000077.4:c.52_83del is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0 population databases. Under the non-VCEP generic ACMG framework, absence from population databases (allele frequency < 0.1%) satisfies PM2 at moderate strength.
gnomad_v2 gnomad_v4 gnomad_canada
PM3 N/A Skipped per adjudication directive — PM3 was explicitly excluded from assessment for this case.
PM4 N/A PM4 applies to in-frame deletions/insertions in a nonrepeat region or stop-loss variants. NM_000077.4:c.52_83del is a 32 bp out-of-frame deletion causing a frameshift and premature termination, not an in-frame change.
PM5 N/A PM5 applies to a novel missense change at the same amino acid residue as a known pathogenic missense variant. NM_000077.4:c.52_83del is a 32 bp deletion causing a frameshift, not a missense variant. PM5 candidate harvesting confirmed no classic same-residue missense comparators are applicable.
PM6 Not met No de novo observation of NM_000077.4:c.52_83del has been reported. PM6 requires a specific de novo report for this exact variant, which was not found in any reviewed publication or database.
PP1 Not met No cosegregation data are available for NM_000077.4:c.52_83del. No family studies reporting segregation of this variant with disease were identified in the reviewed literature.
PP2 N/A PP2 applies specifically to missense variants in genes with a low rate of benign missense variation. NM_000077.4:c.52_83del is a frameshift deletion, not a missense variant.
PP3 Not met In silico prediction tools applicable to this variant type do not provide evidence of deleterious effect. SpliceAI predicts no significant splice impact (max delta score = 0.01). REVEL and BayesDel are not applicable to non-SNV variants. HCI prior scores are not available for CDKN2A. The deleterious effect of this frameshift variant is inherent in its molecular consequence (protein truncation) rather than captured by in silico predictors.
spliceai
PP4 Not met No patient phenotype or clinical data are available for NM_000077.4:c.52_83del. PP4 requires that the patient's phenotype or family history is highly specific for a disease with a single genetic etiology, which cannot be assessed without clinical information.
PP5 Not met ClinVar variation ID 4539651 classifies this variant as 'Likely oncogenic' with a review status of 'criteria provided, single submitter' (1-star). This is a somatic oncogenicity classification, not a germline pathogenicity assertion. Under the PP5/BP6 rule requiring ClinVar 3-star expert panel designation at supporting strength, a 1-star somatic classification does not satisfy PP5. None of the reviewed publications report this specific variant as pathogenic in a germline context.
clinvar
BA1 Not met NM_000077.4:c.52_83del is absent from gnomAD v2.1, v4.1, and Canada population databases. BA1 requires an allele frequency >1% in any population, which is not met.
gnomad_v2 gnomad_v4
BS1 Not met NM_000077.4:c.52_83del is absent from gnomAD population databases. Under the non-VCEP generic framework, BS1 requires an allele frequency >0.3%, which is not met.
gnomad_v2 gnomad_v4
BS2 Not met No data are available regarding observation of NM_000077.4:c.52_83del in healthy adult individuals. The variant is absent from population databases, and no publication reports it in a healthy control cohort.
BS3 Not met No functional study demonstrates that NM_000077.4:c.52_83del has no deleterious effect. Published functional data on CDKN2A truncating variants consistently shows loss of function (PMID:8603820, PMID:8668202), which contradicts a benign functional interpretation.
BS4 Not met No nonsegregation data are available for NM_000077.4:c.52_83del. BS4 requires observation that the variant does not segregate with disease in affected family members, which cannot be assessed without family data.
BP1 N/A BP1 applies to missense variants in genes where truncating variants are the primary disease mechanism. NM_000077.4:c.52_83del is itself a truncating (frameshift) variant, not a missense variant.
BP2 Not met No data are available regarding the observation of NM_000077.4:c.52_83del in trans with a known pathogenic CDKN2A variant. BP2 requires specific phase information, which cannot be assessed without additional genotyping data.
BP3 N/A BP3 applies to in-frame deletions or insertions in repetitive regions without a known function. NM_000077.4:c.52_83del is an out-of-frame deletion causing a frameshift, not an in-frame variant in a repetitive region.
BP4 Not met BP4 requires multiple lines of computational evidence suggesting no impact on the gene or gene product. SpliceAI predicts no significant splicing impact (max delta = 0.01), but the variant creates a frameshift with premature termination at codon 32, which has a clear and severe impact on the protein product regardless of splicing effects. BP4 is not satisfied because the molecular consequence of the variant is unambiguously deleterious.
spliceai
BP5 Not met No data are available indicating that NM_000077.4:c.52_83del is found in a case with an alternative molecular basis for disease. BP5 requires observation of the variant in an affected individual with a clear alternative etiologic cause.
BP6 Not met ClinVar classifies NM_000077.4:c.52_83del as 'Likely oncogenic' (somatic), not as 'Benign' or 'Likely Benign.' BP6 requires a reputable source to report the variant as benign, which is not the case.
clinvar
BP7 N/A BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact. NM_000077.4:c.52_83del is a 32 bp deletion causing a frameshift, not a synonymous variant.
Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.