Variant classification summary

NM_003579.4:c.1093_1169+15dupCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC

RAD54L · NP_003570.2:p.? · NM_003579.4

GRCh37: chr1:46736380 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC · GRCh38: chr1:46270708 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC

Gene: RAD54L Transcript: NM_003579.4

Final call

VUS

PP3 supporting BS1 strong

Variant details

Gene

RAD54L

Transcript

NM_003579.4

Protein

NP_003570.2:p.?

gnomAD AF

0.0004931670006141325 (v4.1)

ClinVar

Likely benign

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PP3 (Supporting): SpliceAI predicts a novel donor splice site with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold.

2

BS1 (Strong): allele frequency exceeds the 0.3% threshold in East Asian (0.734%) and South Asian (0.471%) populations, with 6 homozygotes in gnomAD v4.1.

3

The combination of 1 supporting pathogenic criterion (PP3) with 1 strong benign criterion (BS1) is conflicting evidence that matches no benign, likely benign, likely pathogenic, or pathogenic threshold; the variant is classified as Variant of Uncertain Significance (VUS).

Final determination: Under the generic ACMG/AMP 2015 fallback rules (no RAD54L VCEP/CSPEC retrieved), the only met criteria are BS1 (strong, benign) and PP3 (supporting, pathogenic); the combination fails every benign threshold (BA1 absent, only 1 of 2 BS) and every likely-benign threshold (no BS+BP, no 2 BP), and fails every pathogenic/likely-pathogenic threshold, so the conflicting-evidence combination maps to Variant of Uncertain Significance.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not met	Not met: the protein consequence is unknown (NP_003570.2:p.?) and no RNA or functional data confirm the predicted frameshift or loss of function.	pvs1_generic_framework pvs1_variant_assessment pvs1_gene_context spliceai
PS1	N/A	Not applicable: the duplication has no defined amino-acid consequence (p.?) to compare with an established pathogenic change.	pvs1_variant_assessment pm5_candidates clinvar generic_acmg_combination_rules
PS2	Not assessed	Not assessed: no proband or parental-testing data were available to establish a confirmed de novo occurrence.	generic_acmg_combination_rules
PS3	Not assessed	Not assessed: no functional studies of this exact variant exist; an in silico splice prediction (SpliceAI 0.96) cannot substitute for a validated assay.	generic_acmg_combination_rules clinvar spliceai
PS4	Not assessed	Not assessed: no case-control or affected-cohort prevalence data were available for this variant.	gnomad_v2 gnomad_v4 gnomad_canada generic_acmg_combination_rules
PM1	N/A	Not applicable: this splice-region duplication has no defined amino-acid position (p.?) to evaluate against a hotspot or functional domain.	pvs1_variant_assessment generic_acmg_combination_rules
PM2	Not met	Not met: the highest population allele frequency (South Asian 0.884%, East Asian 0.734%) far exceeds the 0.1% rarity threshold, and homozygotes are observed.	gnomad_v4 gnomad_v2 gnomad_canada generic_acmg_combination_rules
PM3	Not assessed	Not assessed: no proband or family genotype data were available to determine trans phase with a pathogenic variant.	clinvar gnomad_v2 gnomad_v4 gnomad_canada generic_acmg_combination_rules
PM4	Not met	Not met: no in-frame change is established; retaining the 92-bp duplication (not a multiple of 3) would cause a frameshift, not an in-frame insertion.	pvs1_variant_assessment spliceai
PM5	N/A	Not applicable: no missense change at a defined residue exists (p.?) to compare against a previously pathogenic missense.	pm5_candidates pvs1_variant_assessment clinvar generic_acmg_combination_rules
PM6	Not assessed	Not assessed: no proband or parental-testing data were available to support an assumed de novo occurrence.	generic_acmg_combination_rules
PP1	Not assessed	Not assessed: no affected-family segregation data were available.	generic_acmg_combination_rules
PP2	N/A	Not applicable: this is not a missense variant; the duplication has no amino-acid consequence (p.?).	pvs1_variant_assessment pvs1_gene_context generic_acmg_combination_rules
PP3	Met	Met (supporting): SpliceAI predicts a donor splice-site gain with max delta 0.96, above the >=0.8 'very likely' splice-altering threshold.	spliceai generic_acmg_combination_rules
PP4	Not assessed	Not assessed: no proband phenotype or family-history data were available.	generic_acmg_combination_rules
PP5	Not met	Not met: the sole ClinVar submission is a single laboratory's 'Likely benign'; no expert-panel pathogenic classification exists.	clinvar generic_acmg_combination_rules
BA1	Not met	Not met: maximum allele frequency (0.884%, South Asian) is below the 1% BA1 threshold.	gnomad_v4 gnomad_v2 gnomad_canada generic_acmg_combination_rules
BS1	Met	Met (strong): East Asian (0.734%) and South Asian (0.471%) allele frequencies exceed the 0.3% threshold, with 6 homozygotes in gnomAD v4.1. Confidence is moderate because RAD54L disease prevalence and penetrance are not established.	gnomad_v4 gnomad_v2 gnomad_canada generic_acmg_combination_rules
BS2	Not met	Not met: RAD54L is only a putative adult-onset cancer-susceptibility candidate, so the full-penetrance early-onset requirement is not satisfied despite 6 gnomAD homozygotes.	gnomad_v4 gnomad_v2 gnomad_canada generic_acmg_combination_rules
BS3	Not assessed	Not assessed: no functional studies demonstrating a benign (non-damaging) effect were available.	generic_acmg_combination_rules clinvar spliceai
BS4	Not assessed	Not assessed: no affected-family non-segregation data were available.	generic_acmg_combination_rules
BP1	N/A	Not applicable: this is not a missense variant, and BP1 applies to missense changes only.	pvs1_variant_assessment pvs1_gene_context generic_acmg_combination_rules
BP2	Not assessed	Not assessed: no cis/trans phase data relative to a pathogenic variant were available.	clinvar gnomad_v2 gnomad_v4 gnomad_canada generic_acmg_combination_rules
BP3	Not met	Not met: the predicted outcomes are a normal transcript or a frameshift, and exon 10 is not a functionally inert repeat region.	pvs1_variant_assessment spliceai gnomad_canada
BP4	Not met	Not met: the only computational evidence strongly predicts splice impact (SpliceAI max delta 0.96), the opposite of a benign prediction.	spliceai
BP5	Not assessed	Not assessed: no case data on an alternative molecular basis of disease were available.	generic_acmg_combination_rules
BP6	Not met	Not met: the 'Likely benign' label comes from a single laboratory, not an expert panel, so it cannot trigger BP6.	clinvar generic_acmg_combination_rules
BP7	N/A	Not applicable: this is a 92-bp duplication, not a synonymous variant, and SpliceAI predicts strong splice impact.	spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.