Variant classification summary

NM_181523.2:c.1350_1374del

PIK3R1 · NP_852664.1:p.(His450GlnfsTer22) · NM_181523.2

GRCh37: chr5:67589585 CATGAATATAACACTCAGTTTCAAGA>C · GRCh38: chr5:68293757 CATGAATATAACACTCAGTTTCAAGA>C

Gene: PIK3R1 Transcript: NM_181523.2

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PIK3R1

Transcript

NM_181523.2

Protein

NP_852664.1:p.(His450GlnfsTer22)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PVS1 (Very Strong): out-of-frame 25-nt deletion creates a premature stop (p.His450GlnfsTer22) predicted to trigger nonsense-mediated decay.

2

PM2 (Supporting): variant is absent from gnomAD v4.1, below the VCEP <0.00000132 allele-frequency threshold.

3

Combined: PVS1 (+8) + PM2 (+1) = 9 points, yielding Likely Pathogenic under PIK3R1 VCEP Rule 2 (6-9 points).

Final determination:

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met (Very Strong): out-of-frame 25-nt deletion creates a premature stop (p.His450GlnfsTer22) within the VCEP c.917-c.1890 window, predicted to trigger nonsense-mediated decay.	cspec pvs1_gene_context pvs1_variant_assessment spliceai
PS1	N/A	Not applicable: frameshift deletion, not a missense or canonical splice variant, so no same-codon comparator pathway exists.	cspec spliceai
PS2	Not assessed	Not assessed: no proband-level parental testing, maternity/paternity confirmation, or family-history data were available.	cspec
PS3	Not assessed	Not assessed: no functional assay data (kinase activity, protein binding, animal models) for this exact variant were available.
PS4	Not assessed	Not assessed: no proband phenotype scoring, case-control enrichment data, or unrelated affected individuals carrying this variant were available.	cspec clinvar
PM1	N/A	Not applicable: the PIK3R1 VCEP defines no mutational hotspot rule for PM1.	cspec
PM2	Met	Met (Supporting): absent from gnomAD v4.1, below the VCEP <0.00000132 allele-frequency threshold.	cspec gnomad_v4 gnomad_v2 gnomad_canada
PM3	N/A	Not applicable: PM3 is reserved for recessive disorders, and PIK3R1-related disease is autosomal dominant.	cspec
PM4	N/A	Not applicable: 25-nucleotide deletion is out-of-frame, not an in-frame indel, and PM4 is mutually exclusive with PVS1.	cspec pvs1_variant_assessment
PM5	N/A	Not applicable: frameshift deletion, not a missense change, so no same-codon missense comparator applies.	cspec pm5_candidates
PM6	N/A	Not applicable: the VCEP directs apparent de novo cases to PS2 instead of PM6.	cspec
PP1	Not assessed	Not assessed: no affected relatives, pedigree, segregation results, or meiosis counts were available.	cspec
PP2	N/A	Not applicable: the PIK3R1 VCEP marks PP2 as not applicable (missense-only rule).	cspec
PP3	N/A	Not applicable: PP3 covers missense, synonymous, or intronic variants only; this is a frameshift deletion.	spliceai cspec
PP4	Not assessed	Not assessed: no qualifying proband with at least 10 VCEP phenotype points or documented exclusion of an alternative PIK3CD variant.	cspec
PP5	N/A	Not applicable: the VCEP disallows PP5, and this variant is absent from ClinVar.	cspec clinvar
BA1	Not met	Not met: absent from gnomAD v4.1, below the BA1 >=0.00316 allele-frequency threshold.	cspec gnomad_v4
BS1	Not met	Not met: absent from gnomAD v4.1, below the BS1 >=0.000316 allele-frequency threshold.	cspec gnomad_v4
BS2	N/A	Not applicable: the VCEP excludes BS2 due to incomplete penetrance and variable expressivity.	cspec
BS3	Not assessed	Not assessed: no normal-result functional assay data for this exact variant were available.
BS4	Not assessed	Not assessed: no pedigree or affected family members lacking the variant were available.	cspec
BP1	N/A	Not applicable: the VCEP marks BP1 as not applicable (missense-only rule).	cspec
BP2	N/A	Not applicable: the VCEP disallows BP2 because allelic mechanisms for PIK3R1 are incompletely understood.	cspec
BP3	N/A	Not applicable: BP3 applies to in-frame indels in repeat regions; this is an out-of-frame deletion.	cspec
BP4	N/A	Not applicable: BP4 covers missense, synonymous, or intronic variants only; this is a frameshift deletion.	spliceai cspec
BP5	Not assessed	Not assessed: no documented cases where this variant coexisted with an alternative molecular cause of disease were available.	cspec clinvar
BP6	N/A	Not applicable: the VCEP disallows BP6, and this variant is absent from ClinVar.	cspec clinvar
BP7	N/A	Not applicable: BP7 applies to synonymous or intronic variants only; this is an exonic frameshift deletion.	cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.