LYFE Sciences · Project HERA
Variant Interpretation · Classification Report
Variant classification summary
BRCA2
· NP_000050.3:p.(Lys2182AsnfsTer5)
· NM_000059.4
GRCh37: chr13:32915034 GAAAAGAACAGGCTTCACCTAAAAACGTAA>G
·
GRCh38: chr13:32340897 GAAAAGAACAGGCTTCACCTAAAAACGTAA>G
Gene:
BRCA2
Transcript:
NM_000059.4
Final call
Variant details
Gene
BRCA2
Transcript
NM_000059.4
Protein
NP_000050.3:p.(Lys2182AsnfsTer5)
gnomAD AF
ClinVar
OncoKB
Likely Oncogenic
Classification rationale
Interpretation summary
Generated evidence synthesis
1
PVS1 is met at Very Strong strength: this is a frameshift deletion in BRCA2 exon 11 predicted to truncate the protein at residue 2186 of 3418, well upstream of the final exon, in a gene where the ENIGMA CSPEC establishes germline loss of function as the disease mechanism and applies PVS1 at default Very Strong strength for such null variants, with no bundle evidence of NMD escape, exon-skip rescue, or exclusion for this exon.
2
PM4 and BP3 are both not_applicable: the governing ENIGMA BRCA1/BRCA2 VCEP Specification v1.2 explicitly excludes both criteria for BRCA2 gene-wide, and independently this frameshift variant does not fit either criterion's underlying variant-type requirements (in-frame length change / in-frame repeat-region indel).
3
NM_000059.4:c.6546_6574del is a frameshift/PTC-producing 29-bp deletion (p.(K2182Nfs*5)) in BRCA2 exon 11, not a missense or in-frame variant, which removes it from the scope of the classic residue/domain criteria as written in the governing ENIGMA BRCA1/BRCA2 CSPEC v1.2.
4
PM1 and PP2 are globally marked 'Not Applicable' for BRCA2 in the ENIGMA CSPEC v1.2, independent of variant type.
5
PS1 and BP1 are scoped by the CSPEC to missense/silent/in-frame or splicing-impact variants and do not apply to this out-of-frame frameshift deletion.
6
PM5 is repurposed by the CSPEC into a PM5_PTC exon-based rule; exon 11 is confirmed PM5_PTC-eligible (not on the BRCA2 PM5_N/A exon list of E6/E12/E27), but the case bundle's Table 4 excerpt does not resolve the specific per-exon strength code or a comparator previously-proven pathogenic PTC variant, so PM5 is left not_assessed pending review of the full Specifications Table 4 spreadsheet.
7
Variant NM_000059.4:c.6546_6574del / NP_000050.3:p.(Lys2182AsnfsTer5) is a 29 bp frameshift deletion in BRCA2 exon 11, a null/PTC-generating variant type.
8
The ENIGMA ClinGen BRCA1/2 v1.2 specification's PS3/BS3 functional-assay track (Specifications Table 9) is explicitly scoped to missense and synonymous variants and mRNA-transcript (splicing) assays; it does not cover frameshift/deletion null variants, whose loss-of-function status is instead assessed via PVS1 (handled outside this group).
9
No calibrated protein-function or mRNA/minigene assay result specific to this exact deletion was found in Specifications_Table9_V1.2_2024-11-18, HUMU-40-1557-s001 (Parsons 2019), or any fetched full-text publication in this case bundle.
10
Both PS3 and BS3 are therefore returned as not_assessed rather than not_applicable, since the ENIGMA framework does in principle allow functional evidence for null variants via the mRNA-assay/PVS1(RNA) pathway — that pathway simply has no variant-specific data available in this case.
11
NM_000059.4:c.6546_6574del is a 29-bp coding deletion (not a multiple of 3) producing a frameshift, NP_000050.3:p.(Lys2182AsnfsTer5) / p.(K2182Nfs*5), per case_summary.json normalization.
12
The governing ClinGen ENIGMA BRCA1/BRCA2 v1.2 specification (cspec) scopes its PP3/BP4/BP7 bioinformatic-code rules to specific variant categories only: missense or in-frame insertion/deletion/delins inside a functional domain (BayesDel no-AF thresholds), silent variants (SpliceAI thresholds), and intronic variants outside the canonical +/-1,2 splice positions (SpliceAI thresholds). A frameshift-causing out-of-frame exonic deletion is not among these categories and instead falls under the PVS1 null-variant pathway (assessed by a different criteria group), so PP3, BP4, and BP7 are all not_applicable for this variant.
13
SpliceAI was independently checked as a sanity check: max delta score = 0.009 (all four delta scores <=0.009), indicating no significant predicted splicing perturbation even if a splicing-based path had been eligible.
14
REVEL and BayesDel scores were not computed/available for this variant in evidence.json (both null), and per pipeline policy BayesDel lacks a verified published calibration threshold regardless, so neither could support PP3/BP4 even under a hypothetical missense/in-frame-indel framing.
15
No literature (paper_extracts.json) discusses this specific variant's splicing or in-silico predictions; the five full-text papers reviewed are gene-level functional/mechanism papers that do not mention c.6546_6574del.
Final determination:
Criteria assessment
ACMG/AMP criteria review
Criteria shown when status is available
All criteria require review: For research and educational purposes only.
| Criterion | Status | Rationale | Evidence used |
|---|---|---|---|
| PVS1 | Met | NM_000059.4:c.6546_6574del is a 29-bp deletion producing a frameshift, NP_000050.3:p.(Lys2182AsnfsTer5). Mutalyzer prediction places the deletion within c.1910_6841, the ENIGMA-defined coordinate span of BRCA2 exon 11 (the large mid-gene coding exon), well upstream of the final exon (exon 27) and far from the 3' terminus, so the transcript is expected to undergo nonsense-mediated decay and/or produce a severely truncated, non-functional protein (predicted stop at residue 2186 of a 3418-aa reference protein, removing ~36% of the C-terminal coding sequence including the DNA-binding domain aa 2481-3186 and the C-terminal nuclear localization signals/RAD51-binding region). The ClinGen ENIGMA BRCA1/BRCA2 VCEP specification (v1.2) lists PVS1 as applicable with default strength Pathogenic Very Strong for null variants (frameshift, nonsense, canonical splice, initiation codon, single/multi-exon deletion) in BRCA2, a gene with an established germline loss-of-function disease mechanism per the same CSPEC document (pvs1_gene_gate: eligible). BRCA2 exon 11 is not among the exons the ENIGMA Table 4 PVS1 decision table treats as PVS1_N/A, and there is no evidence in this bundle of an alternative in-frame rescue transcript, an exon-skipping mechanism, or escape from NMD for this position, so no downgrade from Very Strong is indicated. Full-text papers retrieved in this case bundle (PMID:10570174, PMID:11239455, PMID:20878484, PMID:22193408, PMID:24312913) do not mention this exact variant and are cited here only for general BRCA2 loss-of-function mechanism context (C-terminal NLS/RAD51-domain truncation causing cytoplasmic mislocalization and HR deficiency), not as variant-specific evidence. |
cspec
pvs1_gene_context
pvs1_variant_assessment
pvs1_generic_framework
vcep_specifications_v1_2_2024_11_18
vcep_specifications_table4_v1_2_2024_11_18
|
| PS1 | N/A | NM_000059.4:c.6546_6574del is a 29-bp out-of-frame deletion producing NP_000050.3:p.(K2182Nfs*5), a frameshift/premature-termination-codon (PTC) variant with no confirmed or predicted effect on mRNA splicing (SpliceAI max delta score 0.01, well below the ENIGMA 0.1 threshold). The ENIGMA BRCA1/BRCA2 CSPEC v1.2 PS1 rule is scoped to (a) predicted missense substitutions where a previously classified pathogenic variant is considered to act via protein change, and (b) exonic/intronic variants with the same predicted splicing impact as a previously classified pathogenic variant. This variant is neither a missense substitution nor a splicing-impact variant, so PS1 is out of scope for this variant type under the governing VCEP specification. |
cspec
|
| PS2 | N/A | PS2 is not applicable under the ENIGMA BRCA2 Version 1.2 specification. The specification states that BRCA1/2-related cancers occur relatively commonly and that there is no information to calibrate the predictive capacity of de novo occurrences. |
cspec
|
| PS3 | Not assessed | NM_000059.4:c.6546_6574del is a 29 bp deletion in BRCA2 exon 11 predicted to cause a frameshift, NP_000050.3:p.(Lys2182AsnfsTer5) — a null/PVS1-type variant, not a missense or synonymous substitution. The ENIGMA BRCA1/2 v1.2 specification restricts PS3 functional-assay application to two data types: (1) protein-function assays (or combined mRNA+protein assays) scored via the curated Specifications Table 9 lookup, which is explicitly scoped to missense and synonymous variants only, and (2) mRNA/transcript-profile (splicing) assays applied as 'PVS1 (RNA)' rather than as PS3. No entry for c.6546_6574del (or any protein-level functional assay of this specific frameshift deletion) is present in Specifications_Table9_V1.2_2024-11-18, and no mRNA/minigene assay result for this exact variant appears anywhere in the case bundle (prefetch, evidence, literature_pass, vcep_materials, fulltext_map, or paper_extracts). SpliceAI predicts no significant splice impact (max delta score = 0.01), so there is no splicing-assay pathway to invoke PVS1(RNA)/PS3 either. No validated protein-function or mRNA assay evidence supports PS3 for this variant. |
|
| PS4 | Not assessed | PS4 cannot be assessed because no ethnicity- and country-matched case-control study, variant-specific odds ratio, confidence interval, or p-value was provided for NM_000059.4:c.6546_6574del. |
cspec
|
| PM1 | N/A | The governing ENIGMA BRCA1/BRCA2 CSPEC v1.2 explicitly marks PM1 as 'Not Applicable' for BRCA2 (the specification does not define a hotspot/functional-domain PM1 rule for this gene, in favor of the domain-based BP4/BP1/BP7 and PM5_PTC framework). No PM1 rule exists to apply to this or any BRCA2 variant under this VCEP specification. |
cspec
|
| PM2 | Not assessed | The variant is reported absent from gnomAD v2.1 and gnomAD v4.1, but the ENIGMA BRCA2 PM2 Supporting rule specifically requires absence from both gnomAD v2.1 non-cancer exome and gnomAD v3.1 non-cancer, plus an average read depth of at least 25 around the variant. The bundle does not provide gnomAD v3.1 results or the required depth metric, so PM2 cannot be applied under the governing specification. |
cspec
gnomad_v2
gnomad_v4
|
| PM3 | Not assessed | The ENIGMA BRCA2 v1.2 specification permits PM3 only for a patient with a phenotype consistent with BRCA1/2-related Fanconi anemia and a co-occurrent pathogenic or likely pathogenic variant in BRCA2, with strength assigned from the Table 6 point total. The bundle provides no affected-proband Fanconi anemia phenotype, chromosome-breakage result, second BRCA2 variant, phase, or trans/cis evidence. The assessed variant is absent from gnomAD v2.1 and v4.1, satisfying the rarity gate described by the specification, but rarity alone does not establish PM3. |
cspec
gnomad_v2
gnomad_v4
|
| PM4 | N/A | The ClinGen ENIGMA BRCA1/BRCA2 VCEP Specification v1.2 explicitly marks PM4 (protein length changes due to in-frame indels or stop-loss variants) as 'Not Applicable' for BRCA2 within the gene-specific criterion table. Additionally, this variant is a frameshift deletion (NP_000050.3:p.(Lys2182AsnfsTer5)), not an in-frame insertion/deletion or stop-loss variant, so PM4's underlying mechanism (protein length change without loss of reading frame) does not apply to this variant type in any case. |
cspec
vcep_specifications_v1_2_2024_11_18
|
| PM5 | Not assessed | Under ENIGMA BRCA1/BRCA2 CSPEC v1.2, PM5 is repurposed away from classic same-residue missense logic (this variant is a frameshift/PTC, not a missense substitution) into a PM5_PTC rule: additional weight for a PTC variant in an exon where a different proven pathogenic PTC variant has already been observed, with exon-specific strength defined in Specifications Table 4. c.6546_6574del falls in BRCA2 exon 11 (coding position 6546 lies within the c.1910-6841 exon-11 span), and the case bundle's Table 4 extract confirms exon 11 (E11) is on the PM5_PTC-applicable exon list (not in the PM5_N/A set of E6/E12/E27). However, the extracted Table 4 rows for exon 11 in this bundle only show PVS1 decision-tree entries (splice-site and deletion/duplication rows); they do not surface a specific exon-11 PM5_PTC strength code (Strong/Moderate/Supporting) or confirm which specific previously-proven pathogenic PTC variant in exon 11 would trigger the code. The pm5_candidates.json artifact for this case independently confirms PM5 was repurposed to PTC/gene-specific logic and returned no resolved candidates or strength recommendation. |
cspec
vcep_specifications_table4_v1_2_2024_11_18
|
| PM6 | N/A | PM6 is not applicable under the ENIGMA BRCA2 Version 1.2 specification. The specification states that BRCA1/2-related cancers occur relatively commonly and that there is no information to calibrate the predictive capacity of de novo occurrences. |
cspec
|
| PP1 | Not assessed | No case-level segregation data are provided for the BRCA2 variant NM_000059.4:c.6546_6574del. The bundle contains no affected relatives, tested relatives, phase information, number of informative meioses, quantitative cosegregation likelihood ratio, or phenotype-linked family structure from which PP1 can be assessed. |
cspec
|
| PP2 | N/A | The governing ENIGMA BRCA1/BRCA2 CSPEC v1.2 explicitly marks PP2 as 'Not Applicable' for BRCA2. Additionally, PP2 (missense-enriched gene mechanism) is not applicable in principle to this variant, which is a frameshift/PTC deletion rather than a missense substitution. |
cspec
|
| PP3 | N/A | NM_000059.4:c.6546_6574del is a 29-bp coding deletion producing NP_000050.3:p.(Lys2182AsnfsTer5) - a frameshift/null variant, not a multiple of 3 bp. The ENIGMA BRCA1/BRCA2 v1.2 specification's PP3 rule is scoped only to: (1) missense or in-frame insertion/deletion/delins variants inside a clinically important functional domain with BayesDel no-AF >=0.30, (2) silent variants inside a functional domain with SpliceAI >=0.2, or (3) intronic variants outside the canonical +/-1,2 donor/acceptor sites with SpliceAI >=0.2. This variant is none of those categories - it is an out-of-frame exonic deletion (frameshift), which falls under the PVS1/null-variant pathway, not the PP3/BP4/BP7 in-silico pathway. SpliceAI itself also shows no meaningful splice-altering signal (max delta score = 0.009, all DS_* <=0.009), so even if a splicing-based path were considered, it would not meet the PP3 SpliceAI>=0.2 threshold. REVEL and BayesDel scores were not available/computed for this variant (both null in evidence.json), and even if a BayesDel score existed, no verified published calibration threshold is available to this pipeline for BayesDel, so it could not be used regardless. |
cspec
spliceai
|
| PP4 | Not assessed | PP4 cannot be assessed because no combined multifactorial clinical LR is available for NM_000059.4:c.6546_6574del. Breast cancer phenotype or family history alone is not sufficiently specific under the BRCA2 specification. |
cspec
vcep_pmid_31853058_brca2_clinical_history_lr
|
| PP5 | Not met | PP5 is not met because ClinVar has no exact-variant record and therefore no exact-variant pathogenic or likely pathogenic expert-panel assertion. |
clinvar
|
| BA1 | Not met | The variant is absent from gnomAD v2.1 and gnomAD v4.1. Therefore, the ENIGMA BRCA2 BA1 threshold of filter allele frequency above 0.1% is not met. |
cspec
gnomad_v2
gnomad_v4
|
| BS1 | Not met | The variant is absent from gnomAD v2.1 and gnomAD v4.1. It does not meet either ENIGMA BRCA2 BS1 frequency interval: FAF >0.0001 and <=0.001 for BS1 Strong, or FAF >0.00002 and <=0.0001 for BS1 Supporting. |
cspec
gnomad_v2
gnomad_v4
|
| BS2 | Not assessed | The ENIGMA BRCA2 BS2 rule requires case-level evidence concerning absence of Fanconi Anemia features and point-based assessment under Specification Table 8. The consolidated case-evidence bundle contains no phenotype, biallelic status, homozygote observation, or Table 8 point calculation for this individual or cohort. |
cspec
|
| BS3 | Not assessed | For the same reasons as PS3: c.6546_6574del is a frameshift deletion outside the missense/synonymous scope of the ENIGMA BS3 functional-assay track (Specifications Table 9), and no calibrated protein-function or mRNA-transcript assay result for this specific variant is present anywhere in the case bundle. No evidence of normal/non-damaging function from a validated assay exists to support BS3. |
|
| BS4 | Not assessed | No case-level non-segregation data are provided for the BRCA2 variant NM_000059.4:c.6546_6574del. The bundle contains no affected family members who tested negative, no quantitative cosegregation likelihood ratio, and no family information allowing evaluation of phenocopies or more than one pathogenic variant in the family. |
cspec
|
| BP1 | N/A | The ENIGMA BRCA1/BRCA2 CSPEC v1.2 BP1 rule applies only to silent substitutions, missense variants, or in-frame insertion/deletion/delins variants located outside a clinically important functional domain, with no splicing impact predicted. NM_000059.4:c.6546_6574del is a 29-bp deletion that is not a multiple of 3 and causes a frameshift (p.(K2182Nfs*5)), i.e. it is an out-of-frame indel, not an in-frame indel, silent, or missense variant. The variant type is therefore outside the scope of the BP1 rule regardless of its position relative to the BRCA2 DNA-binding domain (aa 2481-3186) or PALB2-binding domain (aa 10-40). |
cspec
|
| BP2 | N/A | The ENIGMA BRCA2 v1.2 specification marks BP2 as not applicable and states that it is applied only in the context of BS2. Therefore BP2 is not assigned for this BRCA2 variant, regardless of the absence of documented cis/trans co-occurrence data. |
cspec
|
| BP3 | N/A | The ClinGen ENIGMA BRCA1/BRCA2 VCEP Specification v1.2 explicitly marks BP3 (in-frame indels in a repetitive region without a known function) as 'Not Applicable' for BRCA2 within the gene-specific criterion table. This variant is also a frameshift deletion rather than an in-frame indel in a repeat region, so BP3's underlying mechanism does not apply to this variant type in any case. |
cspec
vcep_specifications_v1_2_2024_11_18
|
| BP4 | N/A | Same variant-category reasoning as PP3. The ENIGMA v1.2 BP4 rule is scoped only to missense/in-frame indel/delins variants inside a functional domain (BayesDel no-AF <=0.18 AND SpliceAI <=0.1), silent variants inside a functional domain (SpliceAI <=0.1), or intronic variants outside the native +/-1,2 splice positions (SpliceAI <=0.1). NM_000059.4:c.6546_6574del is a 29-bp out-of-frame coding deletion causing a frameshift (p.(Lys2182AsnfsTer5)), which is none of these categories - it belongs to the null-variant/PVS1 pathway. SpliceAI max delta = 0.009 is well under the BP4 <=0.1 threshold and would be consistent with 'no predicted splice impact' if a splicing-based path applied, but the variant category itself excludes use of BP4 here. |
cspec
spliceai
|
| BP5 | Not assessed | BP5 cannot be assessed because no combined multifactorial clinical LR against pathogenicity is available for NM_000059.4:c.6546_6574del. Alternate molecular diagnoses or co-observation are not a substitute for this evidence in the ENIGMA BRCA2 specification. |
cspec
vcep_pmid_31853058_brca2_clinical_history_lr
|
| BP6 | Not met | BP6 is not met because ClinVar has no exact-variant record and therefore no exact-variant benign or likely benign expert-panel assertion. |
clinvar
|
| BP7 | N/A | BP7 applies to synonymous (silent) variants with no predicted splicing impact. NM_000059.4:c.6546_6574del is a 29-bp exonic deletion causing a frameshift (NP_000050.3:p.(Lys2182AsnfsTer5)), not a synonymous substitution, so BP7 does not apply regardless of the SpliceAI result. |
|
Disclaimer:
The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.