Variant classification summary

NM_000314.8:c.129_155del

PTEN · NP_000305.3:p.(Glu43_Asp51del) · NM_000314.8

GRCh37: chr10:89653827 TTGAAGGCGTATACAGGAACAATATTGA>T · GRCh38: chr10:87894070 TTGAAGGCGTATACAGGAACAATATTGA>T

Gene: PTEN Transcript: NM_000314.8

Final call

VUS

PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.(Glu43_Asp51del)

gnomAD AF

ClinVar

OncoKB

Unknown Oncogenic Effect

Classification rationale

Interpretation summary

Generated evidence synthesis

1

NM_000314.8:c.129_155del (NP_000305.3:p.(Glu43_Asp51del)) is an in-frame deletion of nine amino acids in exon 2 of PTEN.

2

The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN Expert Panel threshold for PM2_Supporting.

3

The variant is absent from ClinVar, and no proband, de novo, or co-segregation data are available.

4

The deleted residues Glu43-Asp51 lie outside the PTEN catalytic motifs (90-94, 123-130, 166-168), so PM1 and PM4 are not met, and the in-frame deletion is not a null variant for PVS1.

5

The exact 9-residue deletion was not assayed in the Mighell et al. saturation mutagenesis data, so PS3 is not met; single-amino-acid deletions at Glu43 and Asp51 are strongly damaging but do not directly test the multi-residue deletion.

6

Overall, only PM2_Supporting is met, which is insufficient to reach Likely Pathogenic under the PTEN Expert Panel combination rules; the variant is classified as a Variant of Uncertain Significance.

Final determination: No criteria-combination rule matched the adjudicated criteria in the ClinGen PTEN Expert Panel Specifications to the ACMG/AMP Variant Interpretation Guidelines for PTEN Version 3.2 v3.2 framework, so the variant remains a Variant of Uncertain Significance pending human review.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	N/A	NM_000314.8:c.129_155del is an in-frame deletion removing nine amino acids (p.Glu43_Asp51del) without disrupting the reading frame; it is not a null variant (nonsense, frameshift, canonical splice site, or exon-level deletion) and therefore falls outside the PTEN PVS1 decision tree.	vcep_pvs1_decisiontree_pten pvs1_variant_assessment
PS1	Not met	No previously established pathogenic variant with the same amino acid change (p.Glu43_Asp51del) is reported; the variant is absent from ClinVar.	clinvar
PS2	Not met	No de novo observation (with maternity and paternity confirmed) has been reported for this variant.	clinvar
PS3	Not met	The PTEN EP PS3_Moderate rule requires locating the variant in the Mighell et al. 2018 saturation mutagenesis table (Table S2); that table contains only single-residue missense, nonsense, and single-amino-acid deletions, so the exact 9-residue deletion p.Glu43_Asp51del was not directly assayed.	vcep_mmc2
PS4	Not met	The variant is absent from ClinVar with no affected probands, so prevalence in affected individuals cannot be assessed.	clinvar
PS5	N/A	PS5 is not defined in the PTEN Expert Panel specifications or the ACMG/AMP framework.
PM1	Not met	The deleted residues (Glu43-Asp51) lie in the N-terminal region and are outside the PTEN catalytic motifs defined for PM1 (WPD loop 90-94, P-loop 123-130, TI-loop 166-168).	cspec
PM2	Met	The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN EP threshold for PM2_Supporting (allele frequency <0.001%).	gnomad_v2 gnomad_v4 gnomad_canada
PM4	Not met	Although this is an in-frame deletion in a non-repeat region, the PTEN EP PM4 specification limits application to in-frame insertions/deletions impacting at least one catalytic-motif residue; residues Glu43-Asp51 are outside those motifs (90-94, 123-130, 166-168).	cspec
PM5	N/A	PM5 applies to a missense change at a residue with a different established pathogenic missense; this is an in-frame deletion, not a missense variant.	pm5_candidates
PM6	Not met	No assumed de novo observation (without confirmation of paternity/maternity) has been reported for this variant.	clinvar
PP1	Not met	No co-segregation data in affected family members is available for this variant.
PP2	N/A	PP2 applies to missense variants in a gene with a low rate of benign missense variation; this is an in-frame deletion, not a missense variant.	cspec
PP3	Not met	PP3 requires multiple concordant lines of computational evidence (REVEL >0.7 for missense, or SpliceAI plus VarSeak concordance for splicing); REVEL is unavailable for this non-SNV and VarSeak was not run, so the requirement is not satisfied.	spliceai
PP4	N/A	PP4 is not applicable per the PTEN Expert Panel (phenotype specificity is incorporated into PS4).	cspec
PP5	N/A	PP5 is not for use per the PTEN Expert Panel, and the variant is absent from ClinVar (no reputable-source pathogenic classification).	cspec clinvar
BA1	Not met	The variant is absent from gnomAD, so the filtering allele frequency threshold for BA1 (>0.056%) is not met.	gnomad_v2 gnomad_v4
BS1	Not met	The variant is absent from gnomAD, so the BS1 allele frequency range (0.0043%-0.056%) is not met.	gnomad_v2 gnomad_v4
BS2	Not met	The variant has not been observed in the homozygous state in a healthy or PHTS-unaffected individual.	gnomad_v2 gnomad_v4
BS3	Not met	No functional study demonstrates a benign effect on protein function; the exact deletion is not in the Mighell saturation mutagenesis table.	vcep_mmc2
BS4	Not met	No data on lack of segregation in affected family members is available.
BP1	N/A	BP1 (missense variant in a gene where primarily truncating variants cause disease) is not applicable to PTEN per the Expert Panel.	cspec
BP2	Not met	No observation of this variant in trans or in cis with a pathogenic/likely pathogenic PTEN variant has been reported.
BP3	N/A	BP3 (in-frame deletion in a repetitive region without known function) is not applicable to PTEN per the Expert Panel.	cspec
BP4	Not met	Computational evidence does not suggest no impact; SpliceAI predicts possible donor loss (max delta 0.617), and no REVEL score is available, so BP4 is not supported.	spliceai
BP5	Not met	No case with an alternate molecular basis for disease has been identified for this variant.
BP6	N/A	BP6 is not for use per the PTEN Expert Panel, and the variant is absent from ClinVar (no reputable-source benign classification).	cspec clinvar
BP7	N/A	BP7 applies to synonymous or intronic variants with no predicted splice impact; this is an in-frame deletion, not a synonymous/intronic variant.	cspec
PM3	N/A	PTEN causes autosomal dominant PTEN hamartoma tumor syndrome; PM3 (recessive trans requirement) is not applicable.	cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.