Variant classification summary

NM_000314.8:c.765_801+20delinsC

PTEN · NP_000305.3:p.? · NM_000314.8

GRCh37: chr10:89717740 AGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGTTTGTACTTTACTTTCATT>C · GRCh38: chr10:87957983 AGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGTTTGTACTTTACTTTCATT>C

Gene: PTEN Transcript: NM_000314.8

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.?

gnomAD AF

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PVS1 (Very Strong): exon 7 deleted out of frame with near-complete donor loss (SpliceAI 0.999), predicted to trigger nonsense-mediated decay.

2

PM2 (Supporting): absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0, below the 0.001% allele-frequency threshold.

3

Together, PVS1 plus PM2 satisfies Rule20 under the ClinGen PTEN Expert Panel Version 3.2 framework, yielding a Likely Pathogenic classification.

Final determination: Rule20 of the PTEN Expert Panel criteria-combination framework classifies one Pathogenic Very Strong criterion plus one Pathogenic Supporting criterion as Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met at very strong: deletes exon 7 out of frame with near-complete donor loss (SpliceAI 0.999), predicted to trigger nonsense-mediated decay.	cspec vcep_pvs1_decisiontree_pten spliceai
PS1	N/A	Not applicable: no assignable amino-acid substitution or known pathogenic same-amino-acid comparator exists for this complex deletion-insertion.	cspec pm5_candidates
PS2	Not assessed	Not assessed: insufficient evidence was available, with no proband clinical data, parental testing, or de novo observation.	cspec
PS3	Not assessed	Not assessed: no variant-specific RNA, cellular, or biochemical assay result was available; SpliceAI prediction alone is not functional evidence.	cspec vcep_mmc2
PS4	Not assessed	Not assessed: no affected-proband observations, phenotype scores, or case-control data for this exact variant were available.	cspec
PM1	N/A	Not applicable: the variant has no resolved protein residue (p.?), so it cannot be mapped to PTEN's defined catalytic motifs.	cspec
PM2	Met	Met at supporting: absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, below the 0.001% allele-frequency threshold.	cspec gnomad_v2 gnomad_v4 gnomad_canada
PM3	N/A	Not applicable: the PTEN Expert Panel designates PM3 as not applicable, since PHTS is autosomal dominant.	cspec
PM4	Not met	Not met: no established in-frame protein consequence exists, as this is a splice-disrupting loss-of-function variant rather than an in-frame length change.	cspec
PM5	N/A	Not applicable: PM5 requires a missense change at a resolved residue, and no eligible same-residue comparator exists for this variant.	cspec pm5_candidates
PM6	Not assessed	Not assessed: no de novo occurrence, parental testing, or family-history information was available.	cspec
PP1	Not assessed	Not assessed: no family genotypes or meiosis counts were available to evaluate co-segregation.	cspec
PP2	N/A	Not applicable: PP2 applies only to missense variants, and this complex deletion-insertion has no missense consequence.	cspec
PP3	Not assessed	Not assessed: SpliceAI predicts high splice impact (0.999), but no VarSeak result was available to confirm concordance.	cspec spliceai
PP4	N/A	Not applicable: the PTEN Expert Panel explicitly excludes PP4, as phenotype specificity is incorporated into PS4.	cspec
PP5	N/A	Not applicable: ClinVar has no record for this exact variant, so no expert-panel pathogenic assertion exists.	cspec clinvar
BA1	Not met	Not met: absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0, well below the 0.056% stand-alone benign threshold.	cspec gnomad_v2 gnomad_v4 gnomad_canada
BS1	Not met	Not met: absent from population databases, so no allele frequency reaches the BS1 range of 0.0000043 to 0.00056.	cspec gnomad_v2 gnomad_v4 gnomad_canada
BS2	Not assessed	Not assessed: no homozygote observations or clinical data on healthy individuals were available.	cspec gnomad_v2 gnomad_v4 gnomad_canada
BS3	Not assessed	Not assessed: no variant-specific functional study showing a normal, non-damaging effect was available.	cspec vcep_mmc2
BS4	Not assessed	Not assessed: no family genotypes or segregation data were available to test for non-segregation with disease.	cspec
BP1	N/A	Not applicable: the PTEN Expert Panel designates BP1 as not applicable to this gene.	cspec
BP2	Not assessed	Not assessed: no co-occurring variant, phase, cis/trans, or inheritance observations were available.	cspec
BP3	N/A	Not applicable: the PTEN Expert Panel designates BP3 as not applicable to PTEN.	cspec
BP4	Not met	Not met: SpliceAI maximum delta 0.999 vs the 0-0.2 benign range for PTEN.	cspec spliceai
BP5	Not assessed	Not assessed: no cases with an alternate molecular diagnosis were available to exclude an alternative cause.	cspec
BP6	N/A	Not applicable: ClinVar has no record for this exact variant, so no expert-panel benign assertion exists.	cspec clinvar
BP7	N/A	Not applicable: BP7 is limited to synonymous or purely intronic variants, and this variant deletes exonic sequence.	cspec spliceai

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.