Variant classification summary

NM_000465.4:c.1935_1954dup

BARD1 · NP_000456.2:p.(Glu652ValfsTer69) · NM_000465.4

GRCh37: chr2:215595181 T>TCATACTTTTCTTCCTGTTCA · GRCh38: chr2:214730457 T>TCATACTTTTCTTCCTGTTCA

Gene: BARD1 Transcript: NM_000465.4

Final call

Likely Pathogenic

PVS1 strong PM2 moderate

Variant details

Gene

BARD1

Transcript

NM_000465.4

Protein

NP_000456.2:p.(Glu652ValfsTer69)

gnomAD AF

9.045837613584122e-05 (v4.1)

ClinVar

Pathogenic

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PVS1 (Strong): truncating frameshift p.(Glu652ValfsTer69) escapes NMD but deletes the second BRCT domain, a critical functional region.

2

PM2 (Moderate): rare in gnomAD, with maximum subpopulation allele frequency 0.0001178, no homozygotes, and absence from gnomAD-Canada.

3

Likely Pathogenic: combination of one strong (PVS1) plus one moderate (PM2) pathogenic criterion.

Final determination: Under the generic ACMG/AMP 2015 fallback, one strong pathogenic criterion plus one moderate pathogenic criterion yields Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met (Strong): truncating frameshift p.(Glu652ValfsTer69) escapes NMD but removes the second BRCT domain, a critical functional region.	pvs1_generic_framework pvs1_gene_context pvs1_variant_assessment PMID:26738429 PMID:17848578
PS1	N/A	Not applicable: frameshift produces no missense residue to compare against a previously pathogenic amino acid change.	generic_acmg_combination_rules
PS2	Not assessed	Not assessed: no de novo observation with confirmed parentage was documented.
PS3	Not assessed	Not assessed: no validated functional assay of this exact variant was available.	PMID:26738429 PMID:17848578
PS4	Not assessed	Not assessed: no case-control enrichment statistic for this exact variant was available.	PMID:26738429
PM1	N/A	Not applicable: frameshift produces no missense residue to evaluate for mutational hot-spot membership.	generic_acmg_combination_rules
PM2	Met	Met (Moderate): essentially absent from population databases, with maximum subpopulation allele frequency 0.0001178 and no homozygotes.	gnomad_v2 gnomad_v4 gnomad_canada
PM3	Not assessed	Not assessed: no evidence of a second pathogenic variant in trans or a recessive inheritance pattern.
PM4	N/A	Not applicable: frameshift does not alter protein length, so the in-frame length-change criterion does not apply.	pvs1_generic_framework generic_acmg_combination_rules
PM5	N/A	Not applicable: frameshift produces no missense change at the affected residue to compare.	generic_acmg_combination_rules
PM6	Not assessed	Not assessed: no assumed de novo occurrence with parental information was documented.
PP1	Not assessed	Not assessed: no segregation data for this exact variant were available.	PMID:21344236
PP2	N/A	Not applicable: missense-based criterion, and this variant is a frameshift.	generic_acmg_combination_rules
PP3	N/A	Not applicable: frameshift rather than a missense SNV, and SpliceAI predicts no splice alteration (max delta 0.00).	spliceai
PP4	Not assessed	Not assessed: breast/ovarian cancer phenotype is not specific enough to BARD1 to qualify as a highly specific presentation.	PMID:26738429
PP5	Not assessed	Not assessed: no ClinVar expert-panel submission exists for this exact variant.	clinvar
BA1	Not met	Not met: maximum allele frequency 0.0001178 versus the 5% stand-alone benign threshold.	gnomad_v2 gnomad_v4
BS1	Not met	Not met: maximum allele frequency 0.0001178 is far below the frequency expected for a benign BARD1 variant.	gnomad_v2 gnomad_v4 gnomad_canada
BS2	Not assessed	Not assessed: no observations in healthy adults or healthy homozygotes were documented.	gnomad_v2 gnomad_v4
BS3	Not assessed	Not assessed: no functional assay showing preserved normal function of this variant was available.	PMID:17848578 PMID:26738429
BS4	Not assessed	Not assessed: no non-segregation or unaffected-relatives observations were documented.
BP1	N/A	Not applicable: missense-based criterion, and this variant is a frameshift.	generic_acmg_combination_rules
BP2	Not assessed	Not assessed: no phase or co-occurrence data for this variant were available.
BP3	N/A	Not applicable: frameshift, not an in-frame indel in a repetitive region.	pvs1_generic_framework generic_acmg_combination_rules
BP4	N/A	Not applicable: SpliceAI max delta 0.00 does not negate the frameshift's impact, and no missense-predictor evidence applies.	spliceai
BP5	Not assessed	Not assessed: no observation alongside an independent molecular diagnosis explaining the phenotype was documented.
BP6	Not assessed	Not assessed: no ClinVar expert-panel benign assertion exists for this exact variant.	clinvar
BP7	N/A	Not applicable: frameshift alters the protein sequence, so the silent-variant criterion does not apply.	generic_acmg_combination_rules

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.