Variant classification summary

NM_001127500.2:c.3073_3082+25delTTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAG

MET · NP_001120972.1:p.? · NM_001127500.2

GRCh37: chr7:116412033 TTTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAG>T · GRCh38: chr7:116771979 TTTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAG>T

Gene: MET Transcript: NM_001127500.2

Final call

VUS

PM2 supporting PP3 moderate

Variant details

Gene

MET

Transcript

NM_001127500.2

Protein

NP_001120972.1:p.?

gnomAD AF

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PM2 supporting: the exact variant is absent from gnomAD v2.1 and v4.1.

2

PP3 moderate: SpliceAI maximum delta 0.943 exceeds the generic splice-impact threshold of 0.5.

Final determination: Under the generic ACMG/AMP 2015 fallback, one moderate criterion plus one supporting criterion does not meet any defined pathogenic, likely pathogenic, likely benign, or benign combination, resulting in VUS.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not assessed	Not assessed: the deletion spans exon 14 into intron 14i, but its molecular consequence and protein effect are unresolved despite SpliceAI max delta 0.943.	pvs1_generic_framework spliceai
PS1	N/A	Not applicable: the deletion has an unknown protein consequence (p.?), so no same-amino-acid change exists for PS1 comparison.
PS2	Not assessed	Not assessed: no proband-level parental testing or confirmed de novo status is documented.
PS3	Not assessed	Not assessed: no validated MET functional assay was identified; SpliceAI max delta 0.943 is computational evidence, not PS3 assay evidence.	spliceai
PS4	Not assessed	Not assessed: no case-control cohort or exact-variant prevalence/enrichment statistic was available to evaluate PS4.
PM1	N/A	Not applicable: the deletion has no assignable protein residue (p.?), so it cannot be mapped to a critical functional domain or hotspot.
PM2	Met	Met at supporting strength: the variant is absent from gnomAD v2.1 and v4.1 (observed frequency 0), below the PM2 threshold of <=0.0001.	gnomad_v2 gnomad_v4
PM3	Not assessed	Not assessed: no affected-proband, phase, trans-variant, or inheritance observations are documented for this variant.
PM4	N/A	Not applicable: no protein-level in-frame deletion or other length change is established; the reported protein consequence is NP_001120972.1:p.?.
PM5	N/A	Not applicable: the deletion produces an unknown protein consequence (p.?), leaving no defined residue for an alternate-pathogenic-missense comparison.
PM6	Not assessed	Not assessed: no apparently de novo occurrence without confirmed maternity and paternity is documented.
PP1	Not assessed	Not assessed: no affected relatives or informative cosegregating meioses are documented.
PP2	N/A	Not applicable: this is a deletion with an unknown protein consequence, not an interpretable missense substitution eligible for PP2.
PP3	Met	Met: SpliceAI maximum delta 0.943 exceeds the generic PP3 moderate threshold of 0.5 for splice-impact prediction.	spliceai
PP4	Not assessed	Not assessed: no documented phenotype or disease-specific clinical presentation for a carrier of this exact MET variant was available.
PP5	Not met	Not met: ClinVar has no exact-variant record or expert-panel Pathogenic/Likely pathogenic classification for c.3073_3082+25del.	clinvar
BA1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1 (observed frequency 0), far below the generic BA1 threshold of >=0.05.	gnomad_v2 gnomad_v4
BS1	Not met	Not met: gnomAD v2.1 and v4.1 show zero observed alleles for the variant, below the generic BS1 threshold of allele frequency >=0.01.	gnomad_v2 gnomad_v4
BS2	Not assessed	Not assessed: no healthy homozygote or carrier-phenotype observation is available to evaluate the BS2 requirement.	gnomad_v2 gnomad_v4
BS3	Not assessed	Not assessed: no validated benign functional assay was identified, and SpliceAI max delta 0.943 predicts possible splice impact rather than normal function.	spliceai
BS4	Not assessed	Not assessed: no informative unaffected relatives tested negative for the variant are documented.
BP1	N/A	Not applicable: the assessed change is a deletion with unknown protein consequence, not a missense variant eligible for BP1.
BP2	Not assessed	Not assessed: no cis/trans phase, pathogenic-partner, affected-status, or inheritance observations are documented for this variant.
BP3	N/A	Not applicable: no in-frame protein deletion is established, and the variant extends 25 bases into intron 14i rather than defining a protein repeat-region deletion.
BP4	Not met	Not met: SpliceAI maximum delta 0.943 is above the generic BP4 supporting threshold of 0.1.	spliceai
BP5	Not assessed	Not assessed: no confirmed alternative molecular cause or BP5-specific likelihood-ratio value and threshold was available.
BP6	Not met	Not met: ClinVar has no exact-variant record or expert-panel Benign/Likely benign classification for c.3073_3082+25del.	clinvar
BP7	N/A	Not applicable: this is an intronic/splice-region deletion, not a synonymous variant eligible for BP7.

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.