Variant classification summary

NM_000314.8:c.165-10_209+6del

PTEN · NP_000305.3:p.? · NM_000314.8

GRCh37: chr10:89685258 TTTTGTTTTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAG>T · GRCh38: chr10:87925501 TTTTGTTTTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAG>T

Gene: PTEN Transcript: NM_000314.8

Final call

VUS

PVS1 strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.?

gnomAD AF

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PVS1 strong: the PTEN decision tree assigns strong loss-of-function evidence to this in-frame single-exon 3 deletion.

2

PM2 supporting: the variant is absent from gnomAD v2.1 and v4.1.

Final determination: Under the ClinGen PTEN Expert Panel Version 3.2 criteria-combination framework, PVS1 strong plus PM2 supporting does not satisfy a Pathogenic or Likely Pathogenic rule, so the call remains VUS.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met, strong: the PTEN tree assigns strong PVS1 to an in-frame single-exon 3 deletion, with a 45-nucleotide coding deletion and SpliceAI maximum delta 0.996.	vcep_pvs1_decisiontree_pten cspec spliceai
PS1	N/A	Not applicable: c.165-10_209+6del is a multi-base intronic deletion with NP_000305.3:p.? rather than a missense amino-acid change.	cspec clinvar
PS2	Not assessed	Not assessed: no documented proband, parental testing, maternity or paternity confirmation, or qualifying de novo observation is available for the PS2 rule.	cspec
PS3	Not assessed	Not assessed: the intronic deletion has no governing mmc2 missense-table entry or available variant-specific assay demonstrating abnormal splicing.	cspec vcep_mmc2
PS4	Not assessed	Not assessed: no proband specificity scores or case-control enrichment statistics are available to compare with the PTEN PS4 requirements.	cspec
PM1	N/A	Not applicable: the deletion has no resolved protein residue, so it cannot be assessed against PTEN catalytic motifs 90-94, 123-130, or 166-168.	cspec
PM2	Met	Met at supporting: the variant is absent from gnomAD v2.1 and v4.1, below the PTEN PM2 threshold of 0.00001 allele frequency.	cspec gnomad_v2 gnomad_v4
PM3	N/A	Not applicable: the PTEN Expert Panel specification explicitly designates PM3 as not applicable for this autosomal-dominant disorder.	cspec
PM4	Not met	Not met: the 45-nucleotide in-frame deletion is outside PTEN catalytic motifs 90-94, 123-130, and 166-168 required by the VCEP PM4 rule.	cspec spliceai
PM5	N/A	Not applicable: NP_000305.3:p.? provides no amino-acid residue or BLOSUM62 substitution for the PTEN PM5 missense rule.	cspec pm5_candidates
PM6	Not assessed	Not assessed: no presumed de novo observation, proband disease documentation, parental testing, or family-history information is available for PM6.	cspec
PP1	Not assessed	Not assessed: no affected relatives, segregation results, or counted meioses are documented, so the PTEN thresholds of 3, 5, or 7 meioses cannot be evaluated.	cspec
PP2	N/A	Not applicable: this is an intronic deletion with NP_000305.3:p.?, not a missense variant required by the PTEN PP2 rule.	cspec
PP3	N/A	Not applicable: the c.165-10_209+6del deletion changes protein structure rather than representing a missense or qualifying intronic/splice-region variant.	cspec
PP4	N/A	Not applicable: the PTEN VCEP incorporates phenotype specificity into PS4 rather than applying PP4 separately.	cspec
PP5	N/A	Not applicable: the PTEN VCEP excludes PP5, and ClinVar has no exact-variant expert-panel pathogenic assertion.	cspec clinvar
BA1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, yielding observed frequency 0 versus the PTEN BA1 threshold >0.00056.	cspec gnomad_v2 gnomad_v4
BS1	Not met	Not met: gnomAD v2.1 and v4.1 show observed frequency 0, below the PTEN BS1 supporting lower bound of 0.0000043.	cspec gnomad_v2 gnomad_v4
BS2	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, providing zero homozygous population observations required by the PTEN BS2 rule.	cspec gnomad_v2 gnomad_v4
BS3	Not assessed	Not assessed: no variant-specific RNA or mini-gene assay shows preserved splicing, and the governing missense functional table contains no entry for this intronic deletion.	cspec vcep_mmc2
BS4	Not assessed	Not assessed: no affected variant-negative relatives or family-level non-segregation observations are documented for the one-family or two-family BS4 thresholds.	cspec
BP1	N/A	Not applicable: the PTEN VCEP marks BP1 not applicable, and this variant is an intronic deletion rather than a missense change.	cspec
BP2	Not assessed	Not assessed: no documented cis/trans phase or qualifying co-occurring pathogenic PTEN variant observations are available for the required BP2 rule.	cspec
BP3	N/A	Not applicable: the PTEN VCEP excludes BP3, and SpliceAI maximum delta 0.996 predicts splice impact rather than a benign repeat-region change.	cspec spliceai
BP4	N/A	Not applicable: the c.165-10_209+6del deletion changes protein structure rather than representing a missense or qualifying intronic/splice-region variant.	cspec
BP5	Not assessed	Not assessed: no two qualifying cases with a highly penetrant alternate diagnosis and non-overlapping PTEN history are documented.	cspec
BP6	N/A	Not applicable: the PTEN VCEP excludes BP6, and ClinVar has no exact-variant expert-panel benign assertion.	cspec clinvar
BP7	N/A	Not applicable: c.165-10_209+6del is a coding-spanning deletion, not a synonymous variant eligible for BP7.	cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.