Variant classification summary

NM_000314.8:c.165-1_185del

PTEN · NP_000305.3:p.? · NM_000314.8

GRCh37: chr10:89685265 TTAAGGTTTTTGGATTCAAAGCA>T · GRCh38: chr10:87925508 TTAAGGTTTTTGGATTCAAAGCA>T

Gene: PTEN Transcript: NM_000314.8

Final call

Likely Pathogenic

PVS1 very strong PM2 supporting

Variant details

Gene

PTEN

Transcript

NM_000314.8

Protein

NP_000305.3:p.?

gnomAD AF

ClinVar

OncoKB

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PVS1 very strong: canonical splice disruption is predicted to skip critical PTEN exon 3 while preserving the reading frame.

2

PM2 supporting: the variant is absent from gnomAD v2.1, v4.1, and reviewed non-cancer datasets.

Final determination: Rule20 of the ClinGen PTEN Expert Panel Specifications Version 3.2 is satisfied by one PVS1 very strong criterion and one PM2 supporting criterion, resulting in Likely Pathogenic.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met, very strong: canonical splice disruption of exon 3 is predicted to skip the critical exon while preserving the frame, matching the PTEN decision tree's PVS1 branch.	cspec vcep_pvs1_decisiontree_pten
PS1	Not assessed	Not assessed: p.? and no established pathogenic same-position comparator or qualifying comparative in-silico evidence are available for c.165-1_185del.	cspec pvs1_variant_assessment clinvar
PS2	Not assessed	Not assessed: no proband, parental-testing, disease-status, or family-history observations are available to evaluate the VCEP de novo rule.	cspec
PS3	Not assessed	Not assessed: no variant-specific splicing assay was available, and mmc2.xlsx contained no c.165-1_185del or p.? entry for the phosphatase assay.	cspec vcep_mmc2 PMID:29706350
PS4	Not assessed	Not assessed: no case-control odds ratio/statistics or proband phenotype-specificity score is available to compare with the PTEN VCEP PS4 requirements.	cspec
PM1	N/A	Not applicable: the canonical splice variant has protein consequence p.? and no defined amino-acid residue within the VCEP's listed intervals 90-94, 123-130, or 166-168.	cspec pvs1_variant_assessment
PM2	Met	Met at supporting: the variant is absent from gnomAD v2.1, v4.1, and non-cancer subsets, corresponding to allele frequency 0 below the <0.00001 threshold.	cspec gnomad_v2 gnomad_v4
PM3	N/A	Not applicable: The PTEN VCEP explicitly states that PM3 is not applicable to PTEN.	cspec
PM4	N/A	Not applicable: p.? is a canonical splice consequence, not an established in-frame protein insertion/deletion or stop-loss change under the PTEN PM4 rule.	cspec
PM5	N/A	Not applicable: PM5 requires a missense change at an amino-acid residue, whereas c.165-1_185del is a canonical splice variant with p.?.	cspec pvs1_variant_assessment
PM6	Not assessed	Not assessed: no de novo observations, parental-confirmation status, disease status, or family-history information are available for the VCEP PM6 thresholds.	cspec
PP1	Not assessed	Not assessed: no affected relatives or informative meioses are documented, so the VCEP 3-, 5-, or 7-meiosis co-segregation thresholds cannot be applied.	cspec
PP2	N/A	Not applicable: PP2 requires a missense variant, whereas c.165-1_185del is a canonical splice variant with protein consequence p.?.	cspec pvs1_variant_assessment
PP3	Not assessed	Not assessed: SpliceAI max delta 0.976 supports impact, but the VCEP requires concordant SpliceAI and VarSeak results and no VarSeak result is available.	cspec spliceai
PP4	N/A	Not applicable: the PTEN VCEP incorporates phenotype specificity into PS4 Use 2 rather than allowing independent PP4 application.	cspec
PP5	N/A	Not applicable: the PTEN VCEP explicitly prohibits use of PP5 under its governing specification.	cspec
BA1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, rather than exceeding the BA1 threshold of >0.00056 (0.056%).	cspec gnomad_v2 gnomad_v4
BS1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, with no frequency in either BS1 interval of 0.0000043–0.00056.	cspec gnomad_v2 gnomad_v4
BS2	Not met	Not met: gnomAD v2.1 and v4.1 show no variant observations, so there are no qualifying homozygous healthy or PHTS-unaffected individuals.	cspec gnomad_v2 gnomad_v4
BS3	Not assessed	Not assessed: no assay demonstrated preserved splicing, and mmc2.xlsx contained no c.165-1_185del or p.? entry with phosphatase activity >0.	cspec vcep_mmc2 PMID:29706350
BS4	Not assessed	Not assessed: no affected-member non-segregation observation is documented for one family or for two or more families.	cspec
BP1	N/A	Not applicable: the ClinGen PTEN VCEP marks BP1 as Not Applicable.	cspec
BP2	Not assessed	Not assessed: No documented trans, cis, or phase-unknown observation with a different pathogenic or likely pathogenic PTEN variant is available.	cspec
BP3	N/A	Not applicable: the PTEN VCEP specification explicitly designates BP3 as Not Applicable.	cspec
BP4	Not met	Not met: SpliceAI max delta 0.976 is above the VCEP BP4 benign range of 0-0.2 and predicts splice impact, not no impact.	cspec spliceai
BP5	Not assessed	Not assessed: no two cases with an alternate highly penetrant molecular diagnosis and non-overlapping PTEN history are documented.	cspec
BP6	N/A	Not applicable: the PTEN VCEP explicitly prohibits use of BP6 under its governing specification.	cspec
BP7	N/A	Not applicable: the variant disrupts the canonical intronic -1 splice-acceptor position, outside BP7's at-or-beyond -21 intronic scope.	cspec

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.