Variant classification summary

NM_004343.4:c.1099_1150del

CALR · NP_004334.1:p.(Leu367ThrfsTer46) · NM_004343.4

GRCh37: chr19:13054564 AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG>A · GRCh38: chr19:12943750 AGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAG>A

Gene: CALR Transcript: NM_004343.4

Final call

VUS

PS4 strong PM2 supporting

Variant details

Gene

CALR

Transcript

NM_004343.4

Protein

NP_004334.1:p.(Leu367ThrfsTer46)

gnomAD AF

2.9149166829984694e-05 (v4.1)

ClinVar

Pathogenic

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

PS4 strong: the exact variant occurred in 67/148 affected patients versus 0/550 controls, exceeding the case-control enrichment threshold.

2

PM2 supporting: gnomAD v4.1 frequency is 2.91e-5, below the 1e-4 supporting threshold, with zero homozygotes.

Final determination: Under the generic ACMG/AMP 2015 rules, one strong criterion plus one supporting criterion does not meet a Likely Pathogenic or Pathogenic combination, and no benign rule is satisfied; therefore the call is VUS.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Not met	Not met: the exon 9 frameshift is documented as a somatic CALR driver, while PVS1 requires LOF to be a known disease mechanism.	PMID:24325356 PMID:24325359 PMID:25741868
PS1	N/A	Not applicable: PS1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PS2	Not assessed	Not assessed: no germline proband record documents confirmed maternity and paternity, disease, and absence of family history for this variant.	PMID:24325359
PS3	Not assessed	Not assessed: L367fs*46 showed altered localization, but no validated reproducible assay or quantitative threshold establishes a damaging functional effect.	PMID:24325359
PS4	Met	Met: the exact L367fs*46 variant occurred in 67/148 affected patients versus 0/550 controls, yielding continuity-corrected OR 923.2 (95% CI 56.6-15,059.5), above the OR >5.0 threshold.	PMID:24325359
PM1	N/A	Not applicable: PM1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PM2	Met	Met at supporting strength: gnomAD v4.1 AF 2.91e-5 is below the 1e-4 PM2 supporting cutoff, with zero homozygotes.	gnomad_v2 gnomad_v4
PM3	N/A	Not applicable: the exact CALR p.(L367Tfs*46) observation is somatic, with no recessive germline disorder or affected-proband in-trans evidence documented.	PMID:24325359 clinvar
PM4	N/A	Not applicable: PM4 requires a protein-length change, and this is a frameshift variant.	pvs1_generic_framework generic_acmg_combination_rules
PM5	N/A	Not applicable: PM5 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PM6	Not assessed	Not assessed: no germline clinical observation supports assumed de novo status without parental confirmation for this variant.	PMID:24325359
PP1	Not assessed	Not assessed: no multiple affected relatives, informative meioses, or family segregation results are reported for this variant.
PP2	N/A	Not applicable: PP2 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PP3	N/A	Not applicable: the variant is a frameshift, outside the generic PP3 scope for missense or intronic, synonymous, and splice-region variants.	spliceai
PP4	Not assessed	Not assessed: the patient's phenotype and family history are not documented, so specificity for a single-genetic-etiology disease cannot be judged.
PP5	Not met	Not met: ClinVar has no expert-panel classification for this exact variant; its Pathogenic/Likely pathogenic labels come from non-expert submissions.	clinvar
BA1	Not met	Not met: gnomAD v4.1 maximum frequency is 2.91e-5, far below the 0.05 BA1 threshold.	gnomad_v2 gnomad_v4
BS1	Not met	Not met: the highest reported frequency is 0.00120 in a small subgroup, below the generic 0.01 BS1 threshold.	gnomad_v2 gnomad_v4 gnomad_canada
BS2	Not assessed	Not assessed: gnomAD reports zero homozygotes, but no documented healthy adult with the required inheritance and penetrance context is available.	gnomad_v2 gnomad_v4
BS3	Not assessed	Not assessed: the exact variant had altered cellular localization, with no validated assay demonstrating preserved protein function or normal splicing.	PMID:24325359
BS4	Not assessed	Not assessed: no tested affected relatives or documented non-segregation result is available for this variant.
BP1	N/A	Not applicable: BP1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
BP2	Not assessed	Not assessed: no paired pathogenic variant or cis/trans phase observation is reported for the CALR p.(L367Tfs*46) variant.	PMID:24325359 clinvar
BP3	N/A	Not applicable: BP3 requires an in-frame indel in a repeat region, and this is a frameshift variant.	pvs1_generic_framework generic_acmg_combination_rules
BP4	N/A	Not applicable: the variant is a frameshift, and a SpliceAI max delta of 0.092 cannot support BP4 for a truncating protein effect.	spliceai
BP5	Not met	Not met: no case-specific alternate molecular basis for disease is documented, despite cohort-level discussion of mutually exclusive CALR, JAK2, and MPL mutations.
BP6	Not met	Not met: ClinVar has no expert-panel benign or likely benign classification for this exact variant and instead reports Pathogenic/Likely pathogenic submissions.	clinvar
BP7	N/A	Not applicable: BP7 requires a synonymous variant, and this is a frameshift variant.	generic_acmg_combination_rules

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.