Variant classification summary

NM_001904.4:c.115_135del

CTNNB1 · NP_001895.1:p.(Ala39_Ser45del) · NM_001904.4

GRCh37: chr3:41266116 GTGCCACTACCACAGCTCCTTC>G · GRCh38: chr3:41224625 GTGCCACTACCACAGCTCCTTC>G

Gene: CTNNB1 Transcript: NM_001904.4

Final call

VUS

PM2 supporting

Variant details

Gene

CTNNB1

Transcript

NM_001904.4

Protein

NP_001895.1:p.(Ala39_Ser45del)

gnomAD AF

ClinVar

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

VUS: PM2 supporting is met because the exact variant is absent from gnomAD v2.1 and v4.1.

Final determination: Under the generic ACMG/AMP fallback, one supporting criterion alone satisfies none of the benign, likely benign, likely pathogenic, or pathogenic combinations; therefore the call is VUS.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	N/A	Not applicable: PVS1 requires a null variant (nonsense, frameshift, canonical splice, start-loss or stop-loss), and this is an in-frame indel.	pvs1_generic_framework generic_acmg_combination_rules
PS1	N/A	Not applicable: PS1 requires a missense variant, and this is an in-frame indel.	generic_acmg_combination_rules
PS2	Not assessed	Not assessed: maternity, paternity, disease phenotype, and family-history data are not documented.
PS3	Not assessed	Not assessed: the available exon 3 deletion study did not test c.115_135del or p.(Ala39_Ser45del) in a validated variant-specific functional assay.	PMID:29316426
PS4	Not assessed	Not assessed: no exact-variant affected-versus-control counts, odds ratio, or 95% confidence interval are available to test the PS4 threshold of OR/RR >5.0 with CI excluding 1.0.	PMID:29316426
PM1	N/A	Not applicable: PM1 requires a missense variant, and this is an in-frame indel.	generic_acmg_combination_rules
PM2	Met	Met at supporting strength: the variant is absent from gnomAD v2.1 and v4.1, satisfying the <=0.0001 PM2 threshold.	gnomad_v2 gnomad_v4
PM3	N/A	Not applicable: PM3 is restricted to recessive disorders, while the relevant CTNNB1 disorder is autosomal dominant.
PM4	Not assessed	Not assessed: the variant removes seven amino acids, but the available evidence does not establish whether Ala39-Ser45 lies in a non-repeat region.
PM5	N/A	Not applicable: PM5 requires a missense variant, and this is an in-frame indel.	generic_acmg_combination_rules
PM6	Not assessed	Not assessed: no assumed de novo occurrence or parental testing is documented for the variant.
PP1	Not assessed	Not assessed: zero affected relatives and no informative meioses or segregation observations are documented.
PP2	N/A	Not applicable: PP2 requires a missense variant, and this is an in-frame indel.	generic_acmg_combination_rules
PP3	N/A	Not applicable: the variant is an exonic in-frame deletion, outside the generic PP3 scope limited to missense or intronic/synonymous/splice-region variants.
PP4	Not assessed	Not assessed: the patient's phenotype and family history are not documented, so phenotype specificity for a single-gene disease cannot be evaluated.
PP5	Not met	Not met: the exact variant is absent from ClinVar and no exact-variant expert-panel Pathogenic or Likely pathogenic classification is available.	clinvar oncokb
BA1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, not at the >=0.05 allele-frequency threshold for BA1.	gnomad_v2 gnomad_v4
BS1	Not met	Not met: the variant is absent from gnomAD v2.1 and v4.1, with no observed frequency reaching the generic 0.01 BS1 default.	gnomad_v2 gnomad_v4
BS2	Not assessed	Not assessed: no healthy adult heterozygote, homozygote, or hemizygote observation is documented for this variant.
BS3	Not assessed	Not assessed: no well-established assay showed that the exact c.115_135del variant has no damaging effect on protein function or splicing.	PMID:29316426
BS4	Not assessed	Not assessed: no affected relatives with documented variant testing are available to demonstrate non-segregation.
BP1	N/A	Not applicable: BP1 requires a missense variant, and this is an in-frame indel.	generic_acmg_combination_rules
BP2	Not assessed	Not assessed: no pathogenic partner variant or phase evidence is documented for a cis or trans BP2 observation.
BP3	Not met	Not met: the seven-amino-acid exon 3 deletion affects a region reported to contain regulatory phosphorylation sites involved in beta-catenin degradation.	PMID:29316426
BP4	N/A	Not applicable: the variant is an exonic in-frame deletion, outside the generic BP4 scope limited to missense or intronic/synonymous/splice-region variants.
BP5	Not met	Not met: no clinical case documents this exact variant together with an independently established alternate molecular basis for disease.
BP6	Not met	Not met: the exact variant is absent from ClinVar and no exact-variant expert-panel Benign or Likely benign classification is available.	clinvar
BP7	N/A	Not applicable: BP7 requires a synonymous variant, and this is an in-frame indel.	generic_acmg_combination_rules

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.