Variant classification summary

NM_000077.5:c.225_243del

CDKN2A · NP_000068.1:p.(Ala76CysfsTer64) · NM_000077.5

GRCh37: chr9:21971114 CGGGTCGGGTGAGAGTGGCG>C · GRCh38: chr9:21971115 CGGGTCGGGTGAGAGTGGCG>C

Gene: CDKN2A Transcript: NM_000077.5

Final call

Pathogenic

PVS1 very strong PS3 strong PM2 supporting

Variant details

Gene

CDKN2A

Transcript

NM_000077.5

Protein

NP_000068.1:p.(Ala76CysfsTer64)

gnomAD AF

6.23347350337418e-07 (v4.1)

ClinVar

Pathogenic

OncoKB

Likely Oncogenic

Classification rationale

Interpretation summary

Generated evidence synthesis

1

Pathogenic: the exon 2 frameshift truncates CDKN2A and meets PVS1 at very strong strength.

2

Pathogenic: the exact deletion showed abnormal localization, increased Ki67, and nearly absent CDK4/CDK6 binding, meeting PS3 at strong strength.

3

Pathogenic: gnomAD v4.1 shows AF 6.23e-7 with zero homozygotes, supporting PM2.

Final determination: Under the generic ACMG/AMP 2015 rules, one very strong pathogenic criterion plus one strong pathogenic criterion supports a Pathogenic classification; PM2 supporting is additional evidence.

Criteria assessment

ACMG/AMP criteria review

Criteria shown when status is available

All criteria require review: For research and educational purposes only.

Criterion	Status	Rationale	Evidence used
PVS1	Met	Met, very strong: a frameshift in MANE exon 2 truncates CDKN2A from 157 to 139 amino acids without evidence of NMD escape or a non-critical distal exon.	pvs1_gene_context pvs1_variant_assessment pvs1_generic_framework
PS1	N/A	Not applicable: PS1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PS2	Not assessed	Not assessed: no proband-level de novo observation with both maternity and paternity confirmed is documented.
PS3	Met	Met, strong: the exact c.225_243del19 allele showed 1.2% CDK4 binding, 92.3% abnormal localization, and increased Ki67 versus wild-type controls.	PMID:20340136
PS4	Not assessed	Not assessed: PMID:10956390 reports 15 pancreatic-cancer patients in 7 positive families versus none in 8 negative families, but lacks individual case-control denominators for OR and 95% CI.	PMID:25356972
PM1	N/A	Not applicable: PM1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PM2	Met	Met at supporting: gnomAD v4.1 AF is 6.23e-7 with zero homozygotes, below the 0.0001 PM2 threshold.	gnomad_v2 gnomad_v4
PM3	N/A	Not applicable: CDKN2A familial melanoma/cancer predisposition is described as autosomal dominant, whereas PM3 is limited to recessive disorders.
PM4	N/A	Not applicable: PM4 requires a protein-length change, and this is a frameshift variant.	pvs1_generic_framework generic_acmg_combination_rules
PM5	N/A	Not applicable: PM5 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PM6	Not assessed	Not assessed: no assumed de novo occurrence or parental testing showing absence from either parent is documented.
PP1	Not assessed	Not assessed: family-level reporting lacks exact-variant carrier counts, non-carriers, and informative meioses needed to establish cosegregation.	clinvar PMID:25356972
PP2	N/A	Not applicable: PP2 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
PP3	N/A	Not applicable: c.225_243del is a frameshift predicted to cause p.(Ala76CysfsTer64), outside PP3's missense or splice-region/intronic computational scope.
PP4	Not assessed	Not assessed: no individual phenotype or family-history description is available to determine whether the presentation is highly disease-specific.
PP5	Not met	Not met: exact-variant ClinVar submissions are Pathogenic, but expert-panel submissions number 0 and non-expert assertions cannot trigger PP5.	clinvar
BA1	Not assessed	Not assessed: gnomAD v4.1 total AF is 6.23e-7 versus the 0.05 BA1 threshold, but the required grpmax FAF is unavailable.	gnomad_v2 gnomad_v4 clinvar
BS1	Not assessed	Not assessed: gnomAD v4.1 total AF is 6.23e-7 versus the 0.01 BS1 default, but the required grpmax FAF is unavailable.	gnomad_v2 gnomad_v4
BS2	Not assessed	Not assessed: gnomAD shows one allele and zero homozygotes, but does not establish a healthy adult carrier for the BS2 definition.	gnomad_v4
BS3	Not met	Not met: the exact allele has no benign functional result; the available study instead showed 1.2% CDK4 binding and 92.3% abnormal localization.	PMID:20340136
BS4	Not assessed	Not assessed: no tested affected family members lacking the exact variant are documented.
BP1	N/A	Not applicable: BP1 requires a missense variant, and this is a frameshift variant.	generic_acmg_combination_rules
BP2	Not assessed	Not assessed: no pathogenic variant in trans or cis and no parent/offspring phase testing were documented for NM_000077.5:c.225_243del.
BP3	N/A	Not applicable: BP3 requires an in-frame indel in a repeat region, and this is a frameshift variant.	pvs1_generic_framework generic_acmg_combination_rules
BP4	N/A	Not applicable: c.225_243del is a frameshift predicted to cause p.(Ala76CysfsTer64), so absent splice impact cannot support BP4 for the gene product.
BP5	Not assessed	Not assessed: no case-level alternate molecular basis for the patient's disease is documented in the available evidence.
BP6	Not met	Not met: no exact-variant ClinVar expert-panel Benign or Likely benign classification is present, and expert-panel submissions number 0.	clinvar
BP7	N/A	Not applicable: BP7 requires a synonymous variant, and this is a frameshift variant.	generic_acmg_combination_rules

Disclaimer: The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment. Always consult a qualified healthcare professional before making any clinical decisions.