TET2 c.877_901dupAGTGAGGCCTGTGATGCTGATGATG, p.Ala301GlufsTer2
NM_001127208.2:c.877_901dupAGTGAGGCCTGTGATGCTGATGATG
Likely Pathogenic
Final classification of NM_001127208.2:c.877_901dupAGTGAGGCCTGTGATGCTGATGATG in gene TET2 is Likely Pathogenic. This classification is supported by the application of PVS1 due to the truncating nature of the variant and PM2 due to its absence in population databases, indicating it is not a common variant.
ACMG/AMP Criteria Applied
PVS1
PM2
Genetic Information
Gene & Transcript Details
Gene
TET2
Transcript
NM_001127208.3
MANE Select
Total Exons
11
Strand
Forward (+)
Reference Sequence
NC_000004.11
Alternative Transcripts
| ID | Status | Details |
|---|---|---|
| NM_001127208.1 | Alternative | 11 exons | Forward |
| NM_001127208.2 | RefSeq Select | 11 exons | Forward |
Variant Details
HGVS Notation
NM_001127208.2:c.877_901dupAGTGAGGCCTGTGATGCTGATGATG
Protein Change
A301Efs*2
Location
Exon 3
(Exon 3 of 11)
5'Exon Structure (11 total)3'
Functional Consequence
Loss of Function
Related Variants
No evidence of other pathogenic variants at position 301 in gene TET2
Variant interpretation based on transcript NM_001127208.3
Genome Browser
Loading genome browser...
HGVS InputNM_001127208:c.877_901dupAGTGAGGCCTGTGATGCTGATGATG
Active Tracks
ConservationRefSeqClinVargnomAD
Navigation tips: Use mouse to drag and zoom. Click on features for details.
Clinical Data
Population Frequency
Global Frequency
0.0 in 100,000
Extremely Rare
Global: 0.0%
0%
0.05%
0.1%
1%
5%
10%+
ACMG Criteria Applied
PM2
This variant is rare in the population (0.000000% MAF).
Classification
Uncertain Significance (VUS)
Submitter Breakdown
Pathogenic
Likely Path.
VUS
Likely Benign
Benign
Publications (0)
No publication details.
Clinical Statement
This variant has been reported in ClinVar as Uncertain Significance (1 clinical laboratories).
Functional Impact
Functional Domain
Hotspot Status
Not a hotspot
Domain Summary
This variant is not located in a mutational hotspot or critical domain (0 mutations).
Related Variants in This Domain
No evidence of other pathogenic variants at position 301 in gene TET2
Computational Analysis
Pathogenicity Predictions
Predictor Consensus
Unknown
PP3 Applied
No
VCEP Guidelines
Applied ACMG/AMP Criteria (VCEP Specific)
PVS1
PVS1 (Very Strong)
According to VCEP guidelines: 'PVS1 – Null variant in a gene where loss of function (LoF) is a known mechanism of disease.' The evidence for this variant shows: it is a truncating variant (A301Efs*2) in TET2, a gene where loss of function is associated with disease. Therefore, this criterion meets the requirements because the variant is a null variant in a gene known to be affected by loss of function.
PM2
PM2 (Moderate)
According to VCEP guidelines: 'PM2 – Absent from controls (or at extremely low frequency if recessive).' The evidence for this variant shows: it is not found in population databases such as gnomAD, indicating it is absent from controls. Therefore, this criterion meets the requirements because the variant is not present in the general population.