Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
Final classification
VUS
c.284_307delCCCCCGGACTCACACCACAGCCGC

NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides in SRSF2, resulting in loss of 8 amino acids (p.Pro95_Arg102del) at the boundary of the RRM and RS-rich domains.

Gene
N/A
Transcript
N/A
HGVS · transcript:coding
NM_003016.4:c.284_307delCCCCCGGACTCACACCACAGCCGC
Consequence
N/A
GRCh38
N/A
GRCh37
N/A
Basis gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM4 moderate; combination = 1 moderate, which maps to VUS.
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM4 moderate; combination = 1 moderate, which maps to VUS.
Classification rationale
PM4 VUS
c.284_307delCCCCCGGACTCACACCACAGCCGC

NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides in SRSF2, resulting in loss of 8 amino acids (p.Pro95_Arg102del) at the boundary of the RRM and RS-rich domains.1 The deletion meets PM4 (moderate) because it causes a protein length change through an in-frame deletion in a non-repetitive region, per ACMG/AMP 2015 guidelines.2 BP3 is not met because the deleted region is non-repetitive and includes Pro95, a residue of established functional significance in SRSF2.3 PVS1 is not applicable: the variant is an in-frame deletion rather than a null variant. Per ClinGen SVI PVS1 recommendations, in-frame deletions are not eligible for PVS1 at any strength level.4 Population frequency data from gnomAD v2.1 and v4.1 are unavailable due to incomplete variant normalization in the pipeline. gnomAD-Canada reports AC=0, AN=0 (no data), precluding application of PM2, BA1, or BS1. Pro95 is a known somatic mutational hotspot in SRSF2 (ClinVar: P95H Pathogenic, P95L Pathogenic, P95R Likely pathogenic), but germline hotspot evidence for SRSF2 is not established, so PM1 is not met in this context.5 Multiple criteria (PS2, PS3, PS4, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5, BP6) remain not_assessed due to absence of case-level, functional, segregation, or population data in the available evidence. Based on available evidence, the only applicable criterion is PM4 (moderate). The evidence is insufficient to reach a definitive classification; the variant defaults to Variant of Uncertain Significance (VUS) under generic ACMG/AMP 2015 combination rules.6

PM4 VUS
2 generic_acmg_combination_rules
3 generic_acmg_combination_rules
5 generic_acmg_combination_rules
6 generic_acmg_combination_rules
Applied criteria · 1 applied · 18 assessed
Applied · 1
Strength Supporting Moderate Strong Very strong
PM4 moderate Pathogenic
NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides, resulting in loss of 8 amino acids (Pro95 through Arg102) without disruption of the reading frame. The deletion spans a non-repetitive region at the boundary of the RRM domain and the RS-rich domain. Per ACMG/AMP 2015 (PMID:25741868), in-frame deletions in non-repeat regions meet PM4 at moderate strength.
In-frame deletion of 24 bp (c.284_307del) removing 8 amino acids (Pro95_Arg102del). Region is non-repetitivespans RRM-domain boundary. Mutalyzer confirms protein consequence.
Assessed · not applied
Pathogenic
PS2 No de novo occurrence data available for this variant.
PS3 No functional studies evaluating this specific in-frame deletion were identified in the case evidence.
PS4 No case-control or cohort data comparing variant prevalence in affected versus unaffected individuals were identified.
PM1 The deletion removes Pro95, a residue that is a well-known somatic mutational hotspot in SRSF2 for myeloid malignancies (P95H, P95L, P95R are classified as Pathogenic/Likely pathogenic in ClinVar).
PM2 gnomAD v2.1 and v4.1 population frequency data are not available (null values in evidence_brief).
PM6 No de novo occurrence data available.
PP1 No co-segregation data available for this variant.
PP4 No patient phenotype or family history information was provided for this case.
PP5 PP5 requires that a reputable source (e.g., clinical diagnostic laboratory) has reported the variant as pathogenic.
Benign
BA1 BA1 requires an allele frequency >1% in a general population database.
BS1 BS1 requires an allele frequency >0.3% in a general population database.
BS2 No data on observation in healthy adults (homozygous state or in trans with a pathogenic variant) was identified.
BS3 No well-established functional studies showing no damaging effect for this specific variant were identified.
BS4 No segregation data in affected families is available to evaluate lack of segregation.
BP2 No data on observation in trans with a known pathogenic variant was identified.
BP3 BP3 applies to in-frame deletions in repetitive regions without known function.
BP5 BP5 requires observation of the variant in a case where an alternate molecular basis for disease has been identified.
BP6 BP6 requires a reputable source to have reported the variant as benign.
N/A · 8 PVS1 · PS1 · PM5 · PP2 · PP3 · BP1 · BP4 · BP7
Research & evidence
Population frequency
v4.1
This variant is absent from gnomAD v4.1.
v2.1
This variant is absent from gnomAD v2.1.
🇨🇦 CA
This variant is absent from gnomAD-Canada.
Allele frequency by ancestry
three datasets · side by side
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar No data
No ClinVar submissions were recorded for this variant.
In silico No data
No in-silico prediction was recorded for this variant.
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
Sources & reference links

No sources recorded.