Starting
Initialising…
0%
FLT3
Final classification
Likely Pathogenic
FLT3 c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA · p.Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr
FLT3

NM_004119.3:c.1792_1793insACCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATG (p.Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr) is a novel 20-amino-acid in-frame internal tandem duplication (ITD) in the FLT3 juxtamembrane domain at codons 597-598, within the well-established ITD activating hotspot (codons 589-599).

Gene
FLT3
Transcript
NM_004119.3
HGVS · transcript:coding
NM_004119.3:c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA
Consequence
N/A
GRCh38
chr13:28034125 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG
GRCh37
chr13:28608262 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG
Basis Two Moderate criteria (PM1, PM5) plus two Supporting criteria (PS3, PM2) are met. The local FLT3 ITD custom framework classifies '2 Moderate + >=2 Supporting' as Likely Pathogenic. No benign criteria are met.
Two Moderate criteria (PM1, PM5) plus two Supporting criteria (PS3, PM2) are met. The local FLT3 ITD custom framework classifies '2 Moderate + >=2 Supporting' as Likely Pathogenic. No benign criteria are met.
Classification rationale
PS3PM1PM2PM5 Likely Pathogenic
FLT3 c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA

NM_004119.3:c.1792_1793insACCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATG (p.Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr) is a novel 20-amino-acid in-frame internal tandem duplication (ITD) in the FLT3 juxtamembrane domain at codons 597-598, within the well-established ITD activating hotspot (codons 589-599).1 PM1_Moderate is met because the variant maps to the FLT3 juxtamembrane ITD hotspot (codons 589-599), a critical functional domain where recurrent activating ITDs have been established and where no benign population variation is observed in gnomAD. PMID:9737679 documented 47 of 51 FLT3 ITDs in this same codon cluster with constitutive kinase activation.2 PM5_Moderate is met per the local FLT3 custom framework extension: this is a novel ITD in the same established activating juxtamembrane hotspot class as prior pathogenic FLT3 ITDs. The exact inserted sequence need not have been previously characterized; the event is clearly an ITD analogue in the same hotspot mechanism as established activating FLT3 mutations.3 PS3_Supporting is met because OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY), and the broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive kinase activation as the canonical mechanism for juxtamembrane ITDs.4 PM2_Supporting is met because the variant is absent from gnomAD v2.1 and v4.1 (allele frequency 0.0% in all populations).5 The variant is absent from ClinVar and COSMIC. SpliceAI predicts an acceptor gain (delta 0.45), but this is of uncertain clinical significance for an in-frame ITD with an established gain-of-function mechanism.6 Applying the local FLT3 ITD / activating length-mutation framework with generic ACMG/AMP 2015 final combination rules: 2 Moderate criteria (PM1, PM5) plus 2 Supporting criteria (PS3, PM2) meets the threshold for Likely Pathogenic (2 Moderate + >=2 Supporting).7

PS3 + PM1 + PM2 + PM5 Likely Pathogenic
1 PMID:9737679 ↗vcep_flt3_itd_hotspot_and_function
2 PMID:9737679 ↗gnomad_v2 ↗gnomad_v4 ↗vcep_flt3_itd_hotspot_and_function
3 PMID:9737679 ↗PMID:12384447 ↗vcep_flt3_itd_hotspot_and_functionvcep_flt3_oncokb_guidance
7 final_classification_framework
Gene diagram · NM_004119.3 · variants mapped to exon structure
FLT3 NM_004119.3
Fetching transcript structure from UCSC…
Applied criteria · 4 met · select any tile
Met
Not met
Not assessed
N/A
Strength very strong supporting
Pathogenic evidence
PVS
PS
PM
PP
Benign evidence
BA
BS
BP
Rationale
Select a criterion.
Sources
Evidence used
    Gaps remaining
      Rule
      Research & evidence
      Population frequency · supports pathogenic
      gnomAD v4.1 screenshot
      gnomAD v4.1
      gnomAD v2.1 screenshot
      gnomAD v2.1
      Population frequency
      Absent from gnomAD v4.1.
      Absent from gnomAD v2.1.
      This variant is absent from gnomAD-Canada.
      ClinVar screenshot
      ClinVar
      This variant is absent from ClinVar.
      SpliceAI screenshot
      In silico
      SpliceAI predicts possible splice impact for this variant (max delta score = 0.45).
      Functional / OncoKB screenshot
      Functional Likely Oncogenic
      OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.
      OncoKB ↗
      COSMIC screenshot
      COSMIC
      Cancer hotspots screenshot
      Cancer hotspots
      Somatic evidence Not in COSMIC / hotspots
      COSMIC
      This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
      Hotspots
      This variant does not lie in a statistically significant hotspot.
      Literature · 5 PMIDs triaged · 5 high-priority
      5papers screened
      Papers triaged by theme: functional/splicing/segregation/case_observation. high_priority_papers include abstract snippets. Use these to support PS3/BS3/PS4/PP1/PP3/PP5.
      11090077 ↗ functional
      Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.
      Somatic mutations of the receptor tyrosine kinase Flt3 consisting of internal tandem duplications (ITD) occur in 20% of patients with acute myeloid leukemia. They are associated with a poor prognosis of the disease. In this study, we characterized the oncogenic potential and signaling properties of Flt3 mutations. We constructed chimeric molecules that consisted of the murine Flt3 backbone and a 5
      BS3PM1PS3
      11756186 ↗ functional
      FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model.
      FLT3 receptor tyrosine kinase is expressed on lymphoid and myeloid progenitors in the hematopoietic system. Activating mutations in FLT3 have been identified in approximately 30% of patients with acute myelogenous leukemia, making it one of the most common mutations observed in this disease. Frequently, the mutation is an in-frame internal tandem duplication (ITD) in the juxtamembrane region that
      BS3PM1PS3
      12384447 ↗ functional
      A new and recurrent activating length mutation in exon 20 of the FLT3 gene in acute myeloid leukemia.
      Activating length mutations in the juxtamembrane (JM) domain of the FLT3 gene (FLT3-LM) and mutations in the catalytic domain (FLT3D835/836) of this receptor tyrosine kinase represent the most frequent genetic alterations in acute myeloid leukemia (AML). Here, we describe a 6-bp insertion in the activation loop of FLT3 between codons 840 and 841 of FLT3 (FLT3-840GS) in 2 unrelated patients with AM
      BS3PM1PS3
      23631653 ↗ functional
      FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: clinical implications and limitations.
      Internal tandem duplications of the FMS-like tyrosine kinase 3 (FLT3) gene are one of the most frequent gene mutations in acute myeloid leukemia (AML) and are associated with poor clinical outcome. The remission rate is high with intensive chemotherapy, but most patients eventually relapse. During the last decade, FLT3 mutations have emerged as an attractive target for a molecularly specific treat
      BS3PM1PS3
      9737679 ↗ functional
      Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product.
      An internal tandem duplication (ITD) of the FLT3 gene is found in nearly 20% of acute myeloid leukemia (AML) and 5% of myelodysplastic syndrome cases. Our serial studies on 51 samples with the FLT3 gene mutation indicated that the ITD was frequently (47/51) clustered in the tyrosine-rich stretch from codon 589 to 599 and rarely (3/51) in its downstream region, both of which are located within the
      BS3PM1PS3
      Sources & reference links
      7Sources
      ClinVar
      gnomAD v2.1
      gnomAD v4.1
      SpliceAI
      OncoKB
      COSMIC
      Cancer hotspots