Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
CDK6
Final classification
VUS
CDK6 c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC · p.Ala294SerfsTer31
CDK6

PVS1 at moderate strength: NM_001259.8:c.880_955delins is a frameshift variant predicted to result in p.(Ala294SerfsTer31), truncating the C-terminal kinase domain of CDK6. CDK6 loss of function is an established germline disease mechanism. Nonsense-mediated decay is not predicted because the variant is in the last exon (8/8) and the premature termination codon (codon 325) lies within 50 nucleotides of the final exon-exon junction. Under PMC6185798 guidance for truncating variants escaping NMD that affect a critical functional domain, PVS1 is downgraded to moderate.

Gene
CDK6
Transcript
NM_001259.8
HGVS · transcript:coding
NM_001259.8:c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC
Consequence
N/A
GRCh38
chr7:92615166 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA
GRCh37
chr7:92244480 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA
Basis gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 moderate, PM2 moderate; combination = 2 moderate, which maps to VUS.
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 moderate, PM2 moderate; combination = 2 moderate, which maps to VUS.
Classification rationale
PVS1PM2 VUS
CDK6 c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC

PVS1 at moderate strength: NM_001259.8:c.880_955delins is a frameshift variant predicted to result in p.(Ala294SerfsTer31), truncating the C-terminal kinase domain of CDK6. CDK6 loss of function is an established germline disease mechanism. Nonsense-mediated decay is not predicted because the variant is in the last exon (8/8) and the premature termination codon (codon 325) lies within 50 nucleotides of the final exon-exon junction. Under PMC6185798 guidance for truncating variants escaping NMD that affect a critical functional domain, PVS1 is downgraded to moderate.1 PM2 at moderate strength: The variant is absent from gnomAD v2.1 (141,456 individuals), gnomAD v4.1 (807,162 individuals), and gnomAD-Canada v1.0 (HostSeq genomes). No population frequency data supports benign standing variation.2 The variant is absent from ClinVar and COSMIC. No publications, functional data, or family segregation data were identified for this specific variant. Per the generic ACMG/AMP 2015 classification framework (PMID:25741868), PVS1 at moderate plus PM2 at moderate yields two moderate pathogenic criteria, which does not reach the threshold for Likely Pathogenic (requires ≥3 moderate or 1 strong + 1-2 moderate). This variant is classified as a Variant of Uncertain Significance (VUS).3

PVS1 + PM2 VUS
1 pvs1_generic_framework ↗pvs1_gene_contextpvs1_variant_assessment
3 clinvar ↗generic_acmg_combination_rules
Gene diagram · NM_001259.8 · variants mapped to exon structure
CDK6 NM_001259.8
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 16 assessed
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 moderate review Pathogenic
Frameshift variant NM_001259.8:c.880_955delins predicted to result in p.(Ala294SerfsTer31). CDK6 loss of function is an established germline disease mechanism. Under PMC6185798, the variant is in the last exon (8/8) and the premature termination codon at codon 325 is within 50 nucleotides of the final exon-exon junction, so nonsense-mediated decay is not predicted. The truncation removes the C-terminal portion of the kinase domain (residues 294-326) and replaces it with 31 novel amino acids, partially disrupting a well-characterized functional domain. Downgraded from very strong to moderate per PMC6185798 guidance for truncating variants in the last exon that affect a critical functional region but are not expected to undergo NMD.
CDK6 loss of function is supported as a germline disease mechanism by targeted literature review (PMID:41514647PMID:25873077PMID:29149451
PM2 moderate Pathogenic
This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0 (HostSeq genomes). Under generic ACMG/AMP criteria, absence from large population databases supports PM2 at moderate strength (allele frequency below 0.1% threshold).
Absent from gnomAD v2.1 (141456 individuals).Absent from gnomAD v4.1 (807
Assessed · not applied
Pathogenic
PS2 No de novo data available; parental testing was not reported in case materials.
PS3 No functional studies identified for this specific variant or for a systematically characterized range that includes codon 294 in CDK6.
PS4 No case-control or case-series data available for this variant.
PM1 The variant does not lie within a statistically significant mutational hotspot (cancerhotspots.org negative).
PM6 No de novo data available; no parental testing results were provided in case materials.
PP1 No segregation data available for this variant.
PP4 No clinical phenotype or family history data were provided in the case materials to assess specificity for a CDK6-related disorder.
PP5 This variant is absent from ClinVar.
Benign
BA1 This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada.
BS1 This variant is absent from population databases.
BS2 No data available on observation of this variant in healthy adult individuals for a fully penetrant disorder.
BS3 No functional studies identified for this variant demonstrating no damaging effect on protein function.
BS4 No segregation data available to evaluate lack of segregation in affected family members.
BP2 No data available on observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder.
BP5 No data available on whether the proband carries an alternative molecular basis for disease.
BP6 This variant is absent from ClinVar.
N/A · 9 PS1 · PM4 · PM5 · PP2 · PP3 · BP1 · BP3 · BP4 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico No data
No in-silico prediction was recorded for this variant.
Functional / OncoKB screenshot
Functional Unknown Oncogenic Effect
OncoKB identified curated literature and non-variant-specific oncogenicity context for review; listed oncogenicity label: Unknown Oncogenic Effect.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots