Back
NM_000314.6:c.33_54del
p.Asn12MetfsTer5 · PTEN
0%
complete
Final classification
Likely Pathogenic
PVS1PM2
PTEN
c.33_54del
p.Asn12MetfsTer5
This variant

NM_000314.6:c.33_54del is a 22 bp deletion in exon 1 of PTEN causing a frameshift (p.Asn12MetfsTer5) predicted to undergo nonsense-mediated decay, assigned PVS1 at very strong strength under the PTEN VCEP decision tree.

Transcript
NM_000314.6
HGVS · transcript:coding
NM_000314.6:c.33_54del
GRCh38
chr10:87864499 CAGAAACAAAAGGAGATATCAAG>C
GRCh37
chr10:89624256 CAGAAACAAAAGGAGATATCAAG>C
Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.
Classification rationale
PVS1PM2 Likely Pathogenic
PTEN c.33_54del

NM_000314.6:c.33_54del is a 22 bp deletion in exon 1 of PTEN causing a frameshift (p.Asn12MetfsTer5) predicted to undergo nonsense-mediated decay, assigned PVS1 at very strong strength under the PTEN VCEP decision tree.1 The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0, meeting PM2 at supporting strength under PTEN VCEP specifications.2 The variant is absent from ClinVar; no functional studies, segregation data, case observations, or de novo reports were identified in the reviewed literature.3 Under the PTEN VCEP combination rules (Rule20, pathogenic track), PVS1 (Very Strong) plus one Supporting criterion (PM2_Supporting) yields a final classification of Likely Pathogenic.4

PVS1 + PM2 Likely Pathogenic
1 cspec ↗pvs1_gene_contextpvs1_variant_assessment
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000314.6 · variants mapped to exon structure
PTEN NM_000314.6
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 14 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
NM_000314.6:c.33_54del is a 22 bp frameshift deletion in exon 1 producing a premature stop codon at position 16 (p.Asn12MetfsTer5), well 5' to the PTEN NMD threshold at p.D375 (c.1121). Under the PTEN VCEP PVS1 decision tree, a frameshift variant with stop codon at or 5' to p.D375 that is predicted to undergo nonsense-mediated decay in a biologically-relevant transcript is assigned PVS1 at very strong strength.
Frameshift variant introducing premature termination codon at amino acid 16 in exon 1 of 9PTEN PVS1 decision tree: stop codon at or 5' to p.D375 (c.1121) with predicted NMD → PVS1Loss of function is an established disease mechanism for PTEN per CSPEC/VCEP framework
PM2 supporting Pathogenic
This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0. Under PTEN VCEP specifications, PM2 is applied at supporting strength when a variant is absent from population databases (allele frequency < 0.00001 / 0.001%).
Absent from gnomAD v2.1 (0 alleles)Absent from gnomAD v4.1 (0 alleles)Absent from gnomAD-Canada v1.0 (0 alleles)
Assessed · not applied · 14 not met · 0 not assessed
Pathogenic
PS2 No de novo observation of this variant has been reported.
PS3 PTEN VCEP PS3 criteria apply to RNA/mini-gene splicing assays (Strong) or phosphatase activity via Mighell et al.
PS4 PTEN VCEP PS4 requires proband specificity scores.
PM1 PTEN VCEP defines PM1 for residues in catalytic motifs: WPD loop (90-94), P-loop (123-130), and TI-loop (166-168).
PM6 No assumed de novo observations have been reported for this variant.
PP1 No co-segregation data are available for this variant.
PP3 PTEN VCEP PP3 applies to splicing variants with SpliceAI/VarSeak concordance or missense variants with REVEL > 0.7.
Benign
BA1 PTEN VCEP BA1 requires gnomAD filtering allele frequency > 0.00056 (0.056%).
BS1 PTEN VCEP BS1 requires gnomAD filtering allele frequency ≥ 0.0000043 (0.00043%) for supporting or ≥ 0.000043 (0.0043%) for strong.
BS2 PTEN VCEP BS2 requires observation in the homozygous state in a healthy or PHTS-unaffected individual.
BS3 PTEN VCEP BS3 applies to intronic/synonymous variants showing no splicing impact (Strong) or phosphatase activity > 0 via Mighell et al.
BS4 PTEN VCEP BS4 requires lack of segregation in affected family members.
BP2 PTEN VCEP BP2 requires observation in trans with a pathogenic/likely pathogenic PTEN variant or at least three observations in cis/unknown phase with different P/LP variants.
BP5 PTEN VCEP BP5 requires at least two cases where the variant is found with an alternate molecular basis for disease.
N/A · 12 PS1 · PM3 · PM4 · PM5 · PP2 · PP4 · PP5 · BP1 · BP3 · BP4 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.13).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
9Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 2 PMIDs not cited in assessment
11237521 ↗ PTEN: life as a tumor suppressor. ONCOKB
17218262 ↗ Essential role for nuclear PTEN in maintaining chromosomal integrity. ONCOKB