Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
PTEN
Final classification
Likely Pathogenic
PVS1PM2
PTEN
c.324_354del
p.Asp109LeufsTer15
This variant

NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5 of PTEN, predicted to result in a premature termination codon (p.Asp109LeufsTer15) with nonsense-mediated decay. Per the PTEN VCEP PVS1 decision tree, this variant meets PVS1 at very strong strength as the frameshift is predicted to undergo NMD with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8.

Transcript
NM_000314.8
HGVS · transcript:coding
NM_000314.8:c.324_354del
GRCh38
chr10:87933081 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C
GRCh37
chr10:89692838 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C
Basis Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.
Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.
Classification rationale
PVS1PM2 Likely Pathogenic
PTEN c.324_354del

NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5 of PTEN, predicted to result in a premature termination codon (p.Asp109LeufsTer15) with nonsense-mediated decay. Per the PTEN VCEP PVS1 decision tree, this variant meets PVS1 at very strong strength as the frameshift is predicted to undergo NMD with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8.1 The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada, meeting PM2_Supporting per the PTEN VCEP threshold of <0.00001 (0.001%) allele frequency.2 Based on the PTEN VCEP combination rules (Rule1), the presence of one very strong pathogenic criterion (PVS1) is sufficient for a Pathogenic classification.3

PVS1 + PM2 Likely Pathogenic
1 cspec ↗vcep_pvs1_decisiontree_ptenpvs1_gene_contextpvs1_variant_assessment
3 final_classification_frameworkcspec ↗
Gene diagram · NM_000314.8 · variants mapped to exon structure
PTEN NM_000314.8
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 13 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5, predicted to result in a premature termination codon at position 123 (p.Asp109LeufsTer15). Per the PTEN VCEP PVS1 decision tree, the variant is a frameshift predicted to undergo nonsense-mediated decay with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8, warranting PVS1 at very strong strength.
Frameshift deletion at c.324 in exon 5Predicted NMD with termination at codon 1235' to p.D375 (c.1121) threshold
PM2 supporting Pathogenic
This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0, meeting the PTEN VCEP PM2_Supporting threshold of <0.00001 (0.001%) allele frequency.
Absent from gnomAD v2.1Absent from gnomAD v4.1Absent from gnomAD-Canada v1.0
Assessed · not applied · 13 not met · 0 not assessed
Pathogenic
PS2 No de novo observation reported for this variant in ClinVar, published literature, or case-level data.
PS3 No variant-specific functional assay data available.
PS4 No proband or case-control data available for this variant.
PM1 The PTEN VCEP defines PM1-applicable catalytic motifs as residues 90-94 (WPD loop), 123-130 (P-loop), and 166-168 (TI-loop) (NP_000305.3).
PM6 No assumed or confirmed de novo observations have been reported for this variant in any source.
PP1 No co-segregation data available for this variant in any family.
Benign
BA1 The variant is absent from gnomAD populations; does not meet the PTEN VCEP BA1 threshold of filtering allele frequency >0.00056 (0.056%).
BS1 The variant is absent from gnomAD populations; does not meet the PTEN VCEP BS1 threshold (filtering allele frequency 0.000043-0.00056 for BS1_Strong or 0.0000043-0.000043 for BS1_Supporting).
BS2 No observation of this variant in the homozygous state in a healthy or PHTS-unaffected individual has been reported.
BS3 No well-established functional studies demonstrating no damaging effect are available for this variant.
BS4 No segregation data demonstrating lack of segregation in affected family members are available for this variant.
BP2 No observation of this variant in trans with a pathogenic/likely pathogenic PTEN variant, and no observations in cis or phase-unknown with different P/LP PTEN variants.
BP5 No observation of this variant in a case with an alternate molecular basis for disease.
N/A · 12 PS1 · PM4 · PM5 · PP2 · PP3 · PP4 · PP5 · BP1 · BP3 · BP4 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.03).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
9Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 2 PMIDs not cited in assessment
11237521 ↗ PTEN: life as a tumor suppressor. ONCOKB
17218262 ↗ Essential role for nuclear PTEN in maintaining chromosomal integrity. ONCOKB