Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
STK11
Final classification
VUS
STK11 c.539_571delinsTGGTAGGGTGGCACCTC · p.Gly180ValfsTer102
STK11

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is a frameshift variant predicted to cause p.(Gly180ValfsTer102) with a premature termination codon at residue 281, expected to trigger nonsense-mediated decay. Loss of function is an established disease mechanism for STK11 in Peutz-Jeghers syndrome.

Gene
STK11
Transcript
NM_000455.4
HGVS · transcript:coding
NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC
Consequence
N/A
GRCh38
chr19:1220447 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC
GRCh37
chr19:1220446 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC
Basis gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 supporting; combination = 1 very strong + 1 supporting, which maps to VUS.
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 supporting; combination = 1 very strong + 1 supporting, which maps to VUS.
Classification rationale
PVS1PM2 VUS
STK11 c.539_571delinsTGGTAGGGTGGCACCTC

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is a frameshift variant predicted to cause p.(Gly180ValfsTer102) with a premature termination codon at residue 281, expected to trigger nonsense-mediated decay. Loss of function is an established disease mechanism for STK11 in Peutz-Jeghers syndrome.1 The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada population databases, supporting its rarity in the general population.2 The variant is absent from ClinVar and has not been reported in affected individuals, in somatic cancer databases (COSMIC), or in any of the five gene-level functional publications reviewed.3 No variant-specific functional studies, segregation data, de novo observations, or case-control data were identified. Five publications retrieved via OncoKB discuss STK11 function at the gene level but none include NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Under the ClinGen SVI PVS1 decision framework (PMC6185798), a frameshift variant upstream of the last exon in a gene with an established loss-of-function disease mechanism qualifies for PVS1 at full strength.4

PVS1 + PM2 VUS
Gene diagram · NM_000455.4 · variants mapped to exon structure
STK11 NM_000455.4
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 17 assessed
Applied · 2
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
Frameshift variant NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC predicts p.(Gly180ValfsTer102), introducing a premature termination codon at residue 281 within exon 4 of 9 coding exons. Loss of function is a well-established disease mechanism for STK11 in Peutz-Jeghers syndrome. The predicted transcript is expected to undergo nonsense-mediated decay per the ClinGen SVI PVS1 decision framework (PMC6185798).
Frameshift variant in exon 4 of 9 coding exonsLoss of function is established disease mechanism for STK11 (Peutz-Jeghers syndrome)PTC at residue 281 predicted to trigger nonsense-mediated decay
PM2 supporting Pathogenic
NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, indicating it is not observed in large population cohorts.
Absent from gnomAD v2.1 (0 alleles)Absent from gnomAD v4.1 (0 alleles)Absent from gnomAD-Canada v1.0 (0 alleles)
Assessed · not applied
Pathogenic
PS2 No de novo observation has been reported for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC in any reviewed publication or database.
PS3 No variant-specific functional studies were identified for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC.
PS4 The variant is absent from ClinVar and has not been observed in affected individuals in any reviewed source.
PM6 No de novo observation has been reported for this variant in any reviewed publication or database.
PP1 No segregation data are available for this variant.
PP3 In silico tools applicable to indels are limited.
PP4 No phenotype or family history data specific to this variant are available.
PP5 The variant is absent from ClinVar.
Benign
BA1 Allele frequency is 0% across all gnomAD datasets, well below the BA1 threshold of >1%.
BS1 Allele frequency is 0% across all gnomAD datasets, well below the BS1 threshold of >0.3%.
BS2 The variant has not been observed in any healthy adult control population.
BS3 No variant-specific functional studies were identified demonstrating no deleterious effect for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC.
BS4 No segregation or non-segregation data are available.
BP2 No observation of this variant in trans with a known pathogenic STK11 variant has been reported.
BP4 Multiple lines of computational evidence do not suggest a benign effect.
BP5 No observation of this variant in a case where an alternate molecular basis for disease has been identified.
BP6 No reputable source has classified this variant as benign.
N/A · 9 PS1 · PM1 · PM3 · PM4 · PM5 · PP2 · BP1 · BP3 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.47).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 5 PMIDs not cited in assessment
19340305 ↗ Somatic LKB1 mutations promote cervical cancer progression. ONCOKB
19892943 ↗ Structure of the LKB1-STRAD-MO25 complex reveals an allosteric mechanism of kinase activation. ONCOKB
21516316 ↗ The role of LKB1 in lung cancer. ONCOKB
24652667 ↗ STK11 domain XI mutations: candidate genetic drivers leading to the development of dysplastic polyps in Peutz-Jeghers syndrome. ONCOKB
25079552 ↗ Comprehensive molecular profiling of lung adenocarcinoma. ONCOKB