Back
NM_001754.4:c.529_551dup
p.Gln185SerfsTer34 · RUNX1
0%
complete
Final classification
Pathogenic
PVS1PM2PM5
RUNX1
c.529_551dup
p.Gln185SerfsTer34
This variant

The RUNX1 c.529_551dup (p.(Gln185SerfsTer34)) variant has not been observed in COSMIC and has not been reported in ClinVar; OncoKB classifies this variant as Likely Oncogenic with a likely loss-of-function effect.

Transcript
NM_001754.4
HGVS · transcript:coding
NM_001754.4:c.529_551dup
GRCh38
chr21:34859535 C>CGGTGGGTTTGTGAAGACAGTGAT
GRCh37
chr21:36231832 C>CGGTGGGTTTGTGAAGACAGTGAT
RUNX1 MM-VCEP/CSPEC point-based final-classification framework (Tavtigian et al., 2020 Bayesian point system; version 3.1.0). Applied points: PVS1_Very Strong = 8, PM2_Supporting = 1, PM5_Supporting = 1; total = 10 points.
Classification rationale
PVS1PM2PM5 Pathogenic
RUNX1 c.529_551dup

The RUNX1 c.529_551dup (p.(Gln185SerfsTer34)) variant has not been observed in COSMIC and has not been reported in ClinVar; OncoKB classifies this variant as Likely Oncogenic with a likely loss-of-function effect.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.2 This duplication is predicted to cause a frameshift, p.(Gln185SerfsTer34), and SpliceAI predicts no significant splice impact with a maximum delta score of 0.01, which is consistent with applying PVS1 and PM5_Supporting under the RUNX1 MM-VCEP framework.3

PVS1 + PM2 + PM5 Pathogenic
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_001754.4 · variants mapped to exon structure
RUNX1 NM_001754.4
Fetching transcript structure from UCSC…
Applied criteria · 3 applied · 13 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 3
Strength Supporting Moderate Strong Very strong
PVS1 Very Strong review Pathogenic
This duplication causes a frameshift, NM_001754.4:c.529_551dup, predicted to produce p.(Gln185SerfsTer34) in exon 6 of 9 with premature truncation well upstream of the 3' end of RUNX1. RUNX1 loss of function is an established disease mechanism in the MM-VCEP specification, so this finding supports PVS1 at Very Strong strength.
RUNX1 MM-VCEP includes PVS1 guidance.pvs1_gene_context.json: lof_mechanism_supported = true; pvs1_gene_gate = eligible.pvs1_variant_assessment.json: variant_bucket = frameshift; suggested_default_strength = PVS1.
PM2 Supporting review Pathogenic
This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is therefore 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.
gnomAD v2.1: absent.gnomAD v4.1: absent.RUNX1 MM-VCEP PM2_Supporting threshold: frequency less than or equal to 0.00005.
PM5 Supporting review Pathogenic
RUNX1 MM-VCEP allows PM5_Supporting for nonsense or frameshift variants downstream of c.98 when splicing is not predicted to be disrupted and PM1 is not applied. This frameshift occurs at c.529_551, which is downstream of c.98, and SpliceAI shows a maximum delta score of 0.01, which is below the less than or equal to 0.20 splice caveat.
RUNX1 MM-VCEP: PM5_Supporting applies to nonsense/frameshift variants downstream of c.98 with no predicted splice effect and without PM1.SpliceAI max delta score = 0.01.RUNX1 pilot precedent includes downstream frameshift c.292del with PM5_supporting, PM2_supporting, and PVS1.
Assessed · not applied · 4 not met · 9 not assessed
Pathogenic
PP1 No segregation data were identified, so co-segregation with RUNX1-related disease cannot be assessed.
PS2 No confirmed de novo occurrence with maternity and paternity established was identified, so PS2 cannot be assessed.
PM4 This variant is a frameshift duplication, not an in-frame deletion/insertion or stop-loss variant, so PM4 does not apply.
PS1 No previously established pathogenic or likely pathogenic variant producing the same amino acid change or the same splice event was identified, so PS1 was not applied.
PM6 No assumed de novo occurrence in an affected individual was identified, so PM6 cannot be assessed.
PS4 No proband data meeting RUNX1 phenotypic criteria were identified, so PS4 cannot be applied.
PM1 Although codon 185 lies within the RUNX1 runt homology domain, available evidence does not support applying PM1 to this truncating frameshift variant.
PS3 No variant-specific transactivation assay or qualifying secondary functional assay was identified, so PS3 was not applied.
Benign
BP2 No cis/trans observation with another pathogenic RUNX1 variant was identified, so BP2 cannot be assessed.
BS3 No variant-specific functional studies demonstrating normal RUNX1 function were identified, so BS3 cannot be applied.
BS4 No evidence showing non-segregation with disease in informative meioses was identified, so BS4 cannot be assessed.
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1.
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1.
N/A · 12 PP4 · PP5 · BP4 · BP3 · BP6 · BP7 · BP5 · BS2 · PP3 · PP2 · BP1 · PM3
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Loss-of-function.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
CSpec VCEP
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC
Cancer hotspots