Analysis in progress
Initialising…
0%
complete
This report is still being assembled — sections appear as each stage finishes. It isn't final yet.
GNA11
Final classification
Likely Pathogenic
PVS1PM2
GNA11
c.735+1_736-1del
p.?
This variant

NM_002067.5:c.735+1_736-1del is a canonical splice site deletion removing the donor (+1) and acceptor (-1) sites of intron 5 of GNA11, qualifying for PVS1 at very strong strength under ClinGen SVI PVS1 recommendations (PMC6185798), with GNA11 loss of function established as a germline disease mechanism.

Transcript
NM_002067.5
HGVS · transcript:coding
NM_002067.5:c.735+1_736-1del
GRCh38
chr19:3119051 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G
GRCh37
chr19:3119049 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G
Basis gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 moderate; combination = 1 very strong + 1 moderate, which maps to Likely Pathogenic. ▾
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 moderate; combination = 1 very strong + 1 moderate, which maps to Likely Pathogenic.
Classification rationale
PVS1PM2 Likely Pathogenic
GNA11 c.735+1_736-1del

NM_002067.5:c.735+1_736-1del is a canonical splice site deletion removing the donor (+1) and acceptor (-1) sites of intron 5 of GNA11, qualifying for PVS1 at very strong strength under ClinGen SVI PVS1 recommendations (PMC6185798), with GNA11 loss of function established as a germline disease mechanism.1 The variant is absent from gnomAD v2.1 and is observed at an extremely low frequency in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, 0 homozygotes), meeting PM2 at moderate strength.2 Per generic ACMG/AMP 2015 combination rules (Richards et al., PMID:25741868), one Very Strong criterion (PVS1) plus one Moderate criterion (PM2) yields a classification of Likely Pathogenic.3

PVS1 + PM2 → Likely Pathogenic
1 pvs1_generic_framework ↗gnomad_v4 ↗spliceai ↗
2 gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
3 generic_acmg_combination_rules
Gene diagram · NM_002067.5 · variants mapped to exon structure
GNA11 NM_002067.5
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 21 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
✓
PVS1 very strong Pathogenic
NM_002067.5:c.735+1_736-1del deletes the canonical splice donor (+1) and acceptor (-1) sites of intron 5, abrogating normal splicing. GNA11 loss of function is an established germline disease mechanism supported by targeted literature review. SpliceAI predicts strong splice disruption (max delta score = 1.00, with both donor loss and acceptor loss predicted at delta = 1.0). Per ClinGen SVI PVS1 recommendations (PMC6185798), canonical ±1,2 splice variants qualify for PVS1 at very strong strength in genes with established LoF mechanism. No downgrade factors identified.
Canonical splice donor (+1) and acceptor (-1) deletion at intron 5 of NM_002067.5GNA11 germline loss of function mechanism supported by literature (PMID:37053535PMID:39344744
pvs1_generic_framework ↗gnomad_v4 ↗spliceai ↗
✓
PM2 moderate Pathogenic
NM_002067.5:c.735+1_736-1del is absent from gnomAD v2.1 and extremely rare in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, no homozygotes). The population frequency (0.00012%) is well below the 0.1% PM2 threshold for non-VCEP adjudication. Absent from gnomAD-Canada v1.0.
Absent from gnomAD v2.1gnomAD v4.1: AF = 1.24e-06 (2/1613
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
Assessed · not applied · 18 not met · 3 not assessed
Pathogenic
PS2 No de novo data are available for this variant.
PS3 No well-established functional studies have been identified for NM_002067.5:c.735+1_736-1del.
PS4 No case-control or odds ratio data are available comparing the prevalence of this variant in affected individuals versus the general population.
PM1 This variant is not located in an established mutational hotspot or critical functional domain for GNA11.
PM6 No de novo data are available for this variant.
PP1 No segregation data are available for this variant.
PP3 SpliceAI predicts strong splice disruption (max delta = 1.00, DS_AL = 1.00, DS_DL = 1.00).
PP4 No patient phenotype or family history data are available for this case.
PP5 NM_002067.5:c.735+1_736-1del is absent from ClinVar.
Benign
BA1 The highest subpopulation allele frequency for NM_002067.5:c.735+1_736-1del in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population.
BS1 The highest subpopulation allele frequency in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population.
BS2 Two heterozygous carriers are observed in gnomAD v4.1 (2/1,613,802 alleles), but no phenotype data are available for these individuals.
BS3 No well-established functional studies have been identified that demonstrate no damaging effect of this variant on the gene product.
BS4 No family segregation data are available for this variant.
BP1 BP1 applies to missense variants in genes where truncating variants are the primary known disease mechanism.
BP2 No data are available regarding observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder.
BP3 BP3 applies to in-frame deletions or insertions in repetitive regions without a known function.
BP4 Multiple lines of computational evidence do NOT suggest a benign impact.
BP5 No data are available identifying an alternate molecular basis for disease in an individual carrying this variant.
BP6 NM_002067.5:c.735+1_736-1del is absent from ClinVar.
BP7 BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence.
N/A · 5 PS1 · PM3 · PM4 · PM5 · PP2
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
This variant is present in gnomAD v4.1 (AF= 1.23931e-06; MAF= 0.00012%, 2/1613802 alleles, homozygotes = 0) and has highest observed frequency in the Remaining individuals population (AF= 1.6001e-05; MAF= 0.00160%, 1/62496 alleles, homozygotes = 0).
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
0.00012% · 2 / 1,613,802
0 hom
Remaining individuals
1 / 62,496
0.0016%
South Asian
1 / 91,082
0.0011%
+ 8 not observed (Admixed American, European (Finnish), Amish, East Asian, Middle Eastern, Ashkenazi Jewish, African/African American, European (non-Finnish))
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v4 ↗ gnomAD v2 ↗ gnomAD 🇨🇦 ↗
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
ClinVar ↗
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 1.00).
SpliceAI ↗
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has previously been reported in somatic cancers (COSMIC; COSV107230858, n = 1 times).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
7Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC