Final classification

Likely Pathogenic

PS3PM1PM2PM5

FLT3

c.1794_1795insACCATTGATTTCAGAGAATATGAA

p.Glu598_Tyr599insThrIleAspPheArgGluTyrGlu

This variant

Transcript

NM_004119.2

HGVS · transcript:coding

NM_004119.2:c.1794_1795insACCATTGATTTCAGAGAATATGAA

GRCh38

chr13:28034124 A>ATTCATATTCTCTGAAATCAATGGT

GRCh37

chr13:28608261 A>ATTCATATTCTCTGAAATCAATGGT

Local FLT3 ITD / activating length-mutation framework (custom FLT3 criterion specifications with ACMG/AMP 2015 final category thresholds) from final_classification_framework.json.

Classification rationale

PS3PM1PM2PM5 Likely Pathogenic

FLT3 c.1794_1795insACCATTGATTTCAGAGAATATGAA

The FLT3 c.1794_1795insACCATTGATTTCAGAGAATATGAA (p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu); p.(E598_Y599insTIDFREYE)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.¹ This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default PM2 population threshold of 0.1%.² This variant affects the established FLT3 juxtamembrane ITD hotspot at codons 598 to 599; published studies showed recurrent constitutive activation for FLT3 ITDs in the codon 589 to 599 cluster, and OncoKB classifies this exact variant as Likely Oncogenic with a Likely Gain-of-function effect.³ SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.06.⁴

PS3 + PM1 + PM2 + PM5 → Likely Pathogenic

1 cosmic ↗clinvar ↗

2 gnomad_v2 ↗gnomad_v4 ↗

3 oncokb ↗PMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗

4 spliceai ↗

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

Gene diagram · NM_004119.2 · variants mapped to exon structure

FLT3 NM_004119.2

Fetching transcript structure from UCSC…

Applied criteria · 4 applied · 17 assessed

MetEvidence satisfies this criterion.

Not metEvaluated against available evidence; threshold not reached.

Not assessedApplies in principle, but no evidence was found to evaluate it.

N/ADoesn't apply to this variant type.

Applied · 4

Strength Supporting Moderate Strong Very strong

PS3 supporting Pathogenic

OncoKB lists this exact FLT3 p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) variant as Likely Oncogenic with a Likely Gain-of-function effect, and published FLT3 ITD studies support constitutive activation for this mutation class. Under the local FLT3 framework, this supports PS3 at Supporting strength for an exact juxtamembrane ITD-like event.

OncoKB: Likely Oncogenic; biological effect: Likely Gain-of-functionFLT3 ITD literature supports constitutive activation and transformation

oncokb ↗PMID:11090077 ↗PMID:11756186 ↗

PM1 moderate Pathogenic

This in-frame FLT3 insertion affects the juxtamembrane hotspot at codons 598 to 599, within the established codon 589 to 599 activating ITD cluster. Published data showed 47 of 51 FLT3 ITDs localized to codons 589 to 599, supporting PM1_Moderate under the local FLT3 framework.

Protein consequence p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)Classic FLT3 ITD hotspot codons 589-599

PMID:9737679 ↗

PM2 supporting Pathogenic

This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default rarity threshold for PM2 (<0.1%). These population data support PM2 at Supporting strength.

Absent from gnomAD v2.1Absent from gnomAD v4.1

gnomad_v2 ↗gnomad_v4 ↗

PM5 moderate Pathogenic

This novel in-frame FLT3 juxtamembrane insertion falls in the established activating ITD hotspot class at codons 598 to 599, where recurrent pathogenic or oncogenic FLT3 ITDs and activating length mutations are already established. Under the local FLT3 framework, this supports custom PM5_Moderate for a novel activating length-mutation analogue in the same hotspot mechanism class.

Variant lies in codon 589-599 FLT3 ITD hotspotClinVar search found no exact prior submissionPublished activating FLT3 length mutations support hotspot class mechanism

clinvar ↗PMID:9737679 ↗PMID:12384447 ↗

Assessed · not applied · 5 not met · 12 not assessed

Pathogenic

PS2 No confirmed de novo data were identified, so PS2 cannot be assessed.

PS4 No germline case-control enrichment or statistically increased prevalence in affected individuals was identified, so PS4 cannot be assessed.

PM3 No data were identified about occurrence with another pathogenic variant in trans, so PM3 cannot be assessed.

PM6 No assumed de novo occurrence without confirmed parental testing was identified, so PM6 cannot be assessed.

PP1 No segregation data were identified, so PP1 cannot be assessed.

PP4 No phenotype information was provided to determine whether the clinical presentation is highly specific for a FLT3-related disorder, so PP4 cannot be assessed.

PP5 No reputable external germline classification was identified, and PP5 is not used here.

Benign

BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is well below the benign stand-alone threshold of 1% and BA1 is not met.

BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is below the benign strong threshold of 0.3% and BS1 is not met.

BS2 No evidence was identified that this variant is observed in healthy adult individuals at a frequency inconsistent with disease, so BS2 cannot be assessed.

BS3 Available functional evidence does not show a normal or benign effect.

BS4 No segregation data showing lack of cosegregation with disease were identified, so BS4 cannot be assessed.

BP2 No phase information with another variant was identified, so BP2 cannot be assessed.

BP3 This in-frame insertion is located in the established FLT3 juxtamembrane activating hotspot, so the benign repetitive-region criterion BP3 should not be applied.

BP4 SpliceAI predicts no significant splice impact with a maximum delta score of 0.06, but that only argues against a splice-mediated mechanism and does not support a benign overall effect for this activating in-frame hotspot insertion.

BP5 No alternate molecular diagnosis was identified that would explain the phenotype independently of this variant, so BP5 cannot be assessed.

BP6 No reputable external benign classification was identified, and BP6 is not used here.

N/A · 7 PVS1 · PS1 · PM4 · PP2 · PP3 · BP1 · BP7

Research & evidence

Population frequency · supports pathogenic

gnomAD v4.1

gnomAD v2.1

v4.1

Absent from gnomAD v4.1.

v2.1

Absent from gnomAD v2.1.

Allele frequency by ancestry

three datasets · side by side

gnomAD v4.1

Absent · 0 / ?
0 hom

Not observed in any ancestry group.

gnomAD v2.1

Absent · 0 / ?
0 hom

Not observed in any ancestry group.

gnomAD v4 ↗ gnomAD v2 ↗

ClinVar

This variant is absent from ClinVar.

ClinVar ↗

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.06).

SpliceAI ↗

Functional Likely Oncogenic

OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Gain-of-function.

OncoKB ↗

COSMIC

Cancer hotspots

Somatic evidence Not in COSMIC / hotspots

COSMIC

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Hotspots

This variant does not lie in a statistically significant hotspot.

COSMIC ↗ Hotspots ↗

Literature · how each cited paper was used

4papers cited

Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why.

Flt3 mutations from patients with acute myeloid leukemia induce transformation o

PMID 11090077 ↗

Found

Structured finding pending for this record — see source link.

Applied to

→PS3 supporting

FLT3 internal tandem duplication mutations associated with human acute myeloid l

PMID 11756186 ↗

Found

Structured finding pending for this record — see source link.

Applied to

→PS3 supporting

A new and recurrent activating length mutation in exon 20 of the FLT3 gene in ac

PMID 12384447 ↗

Found

Structured finding pending for this record — see source link.

Applied to

→PM5 moderate

Internal tandem duplication of the FLT3 gene is a novel modality of elongation m

PMID 9737679 ↗

Found

Structured finding pending for this record — see source link.

Applied to

→PS3 supporting

→PM1 moderate

→PM5 moderate

Sources & reference links

7Sources

ClinVar

gnomAD v2.1

gnomAD v4.1

SpliceAI

OncoKB

COSMIC

Cancer hotspots

Check your email

Reset your password

Enter an access code

Your allowance