Back
NM_004119.2:c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT
p.Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu · FLT3
Local FLT3 ITD / activating length-mutation framework · vlocal-flt3-itd-framework-v1
0%
complete
Final classification
Likely Pathogenic
PS3PM1PM2PM5
FLT3
c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT
p.Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu
This variant

The FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT (p.(E611_F612insLAWEFPRENLE)) variant has not been reported in ClinVar.

Transcript
NM_004119.2
HGVS · transcript:coding
NM_004119.2:c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT
GRCh38
chr13:28034083 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC
GRCh37
chr13:28608220 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC
Local FLT3 ITD / activating length-mutation framework (local-flt3-itd-framework-v1), which uses ACMG/AMP 2015 final category thresholds with custom FLT3 criterion specifications.
Classification rationale
PS3PM1PM2PM5 Likely Pathogenic
FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT

The FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT (p.(E611_F612insLAWEFPRENLE)) variant has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0.2 Mutalyzer normalization is consistent with an FLT3 internal tandem duplication, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects; the exact p.(E611_F612insLAWEFPRENLE) event also has variant-specific curated evidence consistent with likely gain of function.3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.09.4

PS3 + PM1 + PM2 + PM5 Likely Pathogenic
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_004119.2 · variants mapped to exon structure
FLT3 NM_004119.2
Fetching transcript structure from UCSC…
Applied criteria · 4 applied · 15 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 4
Strength Supporting Moderate Strong Very strong
PS3 supporting review Pathogenic
The exact FLT3 p.(E611_F612insLAWEFPRENLE) event has a variant-specific curated OncoKB entry with Likely Gain-of-function and Likely Oncogenic annotations, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects consistent with this established activating mechanism. In the local FLT3 framework, this supports PS3 at Supporting strength.
Variant-specific OncoKB page reported Likely Gain-of-function and Likely Oncogenic.Published FLT3 ITD studies showed constitutive activation and transforming behavior for this mutation class.
PM1 moderate review Pathogenic
Mutalyzer normalized this variant to NM_004119.2:c.1835_1836ins[GGCT;1807_1835], indicating duplication of a nearby reference interval consistent with an FLT3 internal tandem duplication. The protein consequence p.(E611_F612insLAWEFPRENLE) lies in the juxtamembrane region, and published FLT3 ITD data showed that the classic activating hotspot is centered in codons 589-599. In the local FLT3 framework, a juxtamembrane ITD/activating length-mutation event in this established hotspot mechanism meets PM1_Moderate.
Normalized description showed duplicated reference sequence consistent with ITD-class event.Protein effect is a juxtamembrane in-frame insertion.FLT3 ITD hotspot literature supports this region as an established activating hotspot.
PM2 supporting review Pathogenic
This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so its observed population frequency is 0 and remains below the usual PM2 rarity threshold of 0.1%. This supports PM2 at Supporting strength.
Absent from gnomAD v2.1.Absent from gnomAD v4.1.Absent from gnomAD-Canada v1.0.
PM5 moderate review Pathogenic
The local FLT3 framework uses a custom PM5 rule for novel in-frame internal tandem duplications and activating length mutations in the established juxtamembrane hotspot class rather than classic same-residue missense logic. This variant is an in-frame juxtamembrane ITD-class event, and published FLT3 literature has already established pathogenic/oncogenic activating length mutations in this hotspot mechanism. This supports PM5_Moderate under the local FLT3 framework.
PM5 candidate artifact flagged that this case uses a custom length-mutation PM5 mode rather than classic same-residue missense PM5.Local FLT3 framework allows PM5 for novel ITD/activating length-mutation analogues in the same hotspot class.
Assessed · not applied · 6 not met · 9 not assessed
Pathogenic
PS2 No confirmed de novo data were identified, so PS2 cannot be assessed.
PS4 No case-control or enrichment data comparing affected and unaffected individuals were identified, so PS4 was not assessed.
PM6 No assumed de novo data without confirmed parentage were identified, so PM6 was not assessed.
PP1 No segregation data were identified, so PP1 cannot be assessed.
PP3 Computational evidence does not support a damaging splicing effect.
PP4 No specific germline phenotype or family-level clinical presentation was provided that would allow PP4 assessment.
Benign
BA1 This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not meet the BA1 stand-alone benign frequency threshold of greater than 1%.
BS1 This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not exceed the BS1 benign frequency threshold of greater than 0.3%.
BS2 No evidence was identified showing this variant in a sufficient number of healthy adults for BS2 assessment.
BS3 Available functional evidence does not show a benign or normal effect.
BS4 No segregation data showing lack of cosegregation with disease were identified, so BS4 was not assessed.
BP2 No phase data with another pathogenic variant were identified, so BP2 was not assessed.
BP3 BP3 should not be applied to FLT3 juxtamembrane internal tandem duplication or activating length-mutation events because this region has a known activating disease mechanism and recurrent pathogenic/oncogenic variation.
BP4 SpliceAI predicts no significant splice impact for this variant with a maximum delta score of 0.09, but this does not provide benign support for an in-frame juxtamembrane FLT3 insertion with an established activating protein-level mechanism.
BP5 No alternate molecular explanation for a reported phenotype was identified, so BP5 was not assessed.
N/A · 9 PVS1 · PS1 · PM3 · PM4 · PP2 · PP5 · BP1 · BP6 · BP7
Research & evidence
Population frequency · supports pathogenic
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.09).
Functional / OncoKB screenshot
Functional Likely Oncogenic
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Literature · how each cited paper was used
4papers cited
Each card is an audit: what was searched, what was found, whether it names the variant, which criteria it fed, and why. 2 further PMIDs triaged but not cited — see Sources & references.
Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.
Found
Structured finding pending for this record — see source link.
Applied to
PS3 supporting
PM1 moderate
FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model.
Found
Structured finding pending for this record — see source link.
Applied to
PS3 supporting
PM1 moderate
A new and recurrent activating length mutation in exon 20 of the FLT3 gene in acute myeloid leukemia.
Found
Structured finding pending for this record — see source link.
Applied to
PS3 supporting
PM5 moderate
Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product.
Found
Structured finding pending for this record — see source link.
Applied to
PS3 supporting
PM1 moderate
PM5 moderate
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 2 PMIDs not cited in assessment
23631653 ↗ FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: clinical implications and limitations. ONCOKB
26438511 ↗ Profiling of somatic mutations in acute myeloid leukemia with FLT3-ITD at diagnosis and relapse. ONCOKB