Back
NM_022552.4:c.856-59_1014+13dup
p.? · DNMT3A
ACMG/AMP
0%
complete
Final classification
VUS
PM2PP3
DNMT3A
c.856-59_1014+13dup
p.?
This variant

The DNMT3A c.856-59_1014+13dup (p.?) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

Transcript
NM_022552.4
HGVS · transcript:coding
NM_022552.4:c.856-59_1014+13dup
GRCh38
chr2:25247577 A>ACCCCACAACTTACCACTGAGAATTTGCCGTCTCCGAACCACATGACCCAGCGGGTGCCTTCAGCTGCTCGGCTCCGGCCCGTCATCCACCAAGACACAATGCGGCCTGGCCACCAGGAGAAGCCCCGCAGTTTCCCCCACACCAGCTCCCCAATGCCAAAGCCCCGGCCGTCCTGGAGCCCCAAGGAGCAGAAATCATTACACAGTGGTCACGAGGCCCTGCCACCCTGAT
GRCh37
chr2:25470446 A>ACCCCACAACTTACCACTGAGAATTTGCCGTCTCCGAACCACATGACCCAGCGGGTGCCTTCAGCTGCTCGGCTCCGGCCCGTCATCCACCAAGACACAATGCGGCCTGGCCACCAGGAGAAGCCCCGCAGTTTCCCCCACACCAGCTCCCCAATGCCAAAGCCCCGGCCGTCCTGGAGCCCCAAGGAGCAGAAATCATTACACAGTGGTCACGAGGCCCTGCCACCCTGAT
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting, PP3 supporting; combination = 2 supporting, which maps to VUS.
Classification rationale
PM2PP3 VUS
DNMT3A c.856-59_1014+13dup

The DNMT3A c.856-59_1014+13dup (p.?) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is below the non-VCEP PM2 threshold of 0.1%.2 SpliceAI predicts a strong splice effect with a maximum delta score of 0.91, supporting possible abnormal splicing, although the exact transcript consequence of this intragenic duplication remains uncertain.3

PM2 + PP3 VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_022552.4 · variants mapped to exon structure
DNMT3A NM_022552.4
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 21 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PM2 supporting review Pathogenic
This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is below the non-VCEP PM2 threshold of 0.1%, supporting rarity.
Absent from gnomAD v2.1.Absent from gnomAD v4.1.
PP3 supporting review Pathogenic
SpliceAI predicts a strong splice effect for this variant, with a maximum delta score of 0.91, which is above commonly used concern thresholds and supports an abnormal splicing effect. REVEL and BayesDel were not available because this is not an SNV.
SpliceAI max delta score 0.91.Predicted acceptor gain and donor gain signals are high.
Assessed · not applied · 5 not met · 16 not assessed
Pathogenic
PVS1 Loss of function is an established DNMT3A disease mechanism, but this duplication does not fall into the default generic PVS1 null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants.
PS2 No confirmed de novo occurrence with verified maternity and paternity was identified for this variant, so PS2 cannot be assessed from the available evidence.
PS3 No well-established functional study was identified for this variant.
PS4 No evidence was identified showing that this exact variant is enriched in affected individuals compared with controls, so PS4 is not met.
PM1 No evidence was identified that this duplication affects a well-established critical functional domain or mutational hot spot without benign variation.
PM4 This intragenic duplication spans intronic sequence on both sides of a coding segment, and the actual transcript and protein consequences remain uncertain.
PM6 No report was identified showing this variant to be apparently de novo without confirmed parentage, so PM6 cannot be assessed.
PP1 No segregation data were identified for this variant, so PP1 cannot be assessed.
PP4 No phenotype or family history information was provided to determine whether the clinical presentation is highly specific for a DNMT3A-related disorder, so PP4 cannot be assessed.
PP5 No reputable source classification for this exact variant was identified.
Benign
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1 and therefore does not meet the stand-alone benign frequency threshold of 1%.
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1 and therefore does not meet the benign strong frequency threshold of 0.3%.
BS2 No evidence was identified showing this variant in healthy adult individuals in a context sufficient to support BS2.
BS3 No well-established functional study showing no damaging effect was identified for this variant, so BS3 cannot be applied.
BS4 No non-segregation data were identified for this variant, so BS4 cannot be assessed.
BP2 No phase data or additional variant data were identified to support BP2.
BP3 No evidence was identified showing that this duplication lies within a repetitive region without known function in a way that would support BP3.
BP4 Available computational evidence does not support a benign interpretation.
BP5 No alternate molecular explanation was identified that would allow BP5 to be assessed.
BP6 No reputable source benign classification was identified for this exact variant.
BP7 BP7 is not supported because computational evidence predicts splice disruption rather than no impact on splicing.
N/A · 5 PS1 · PM3 · PM5 · PP2 · BP1
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.91).
Functional No data
No calibrated functional assay or RNA evidence was identified for this variant.
OncoKB ↗
COSMIC screenshot
COSMIC
Somatic evidence
COSMIC
This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant cancer hotspot.
COSMIC ↗
Sources & reference links
6Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
SpliceAI
OncoKB
COSMIC