Back
NM_203407.3:c.860_892del
p.Gly287_Pro297del · EZHIP
ACMG/AMP
0%
complete
Final classification
VUS
PM2PM4
EZHIP
c.860_892del
p.Gly287_Pro297del
This variant

NM_203407.3:c.860_892del (p.Gly287_Pro297del) is an in-frame deletion of 11 amino acids within exon 1 of EZHIP, a gene for which loss-of-function is a supported germline disease mechanism.

Transcript
NM_203407.3
HGVS · transcript:coding
NM_203407.3:c.860_892del
GRCh38
chrX:51407860 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T
GRCh37
chrX:51150712 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting, PM4 moderate; combination = 1 moderate + 1 supporting, which maps to VUS.
Classification rationale
PM2PM4 VUS
EZHIP c.860_892del

NM_203407.3:c.860_892del (p.Gly287_Pro297del) is an in-frame deletion of 11 amino acids within exon 1 of EZHIP, a gene for which loss-of-function is a supported germline disease mechanism.1 This variant is extremely rare in population databases, with an allele frequency of 0.00135% in gnomAD v2.1 (2/147,648 alleles) and 0.00239% in gnomAD v4.1 (13/544,257 alleles), meeting PM2 at supporting strength.2 As an in-frame deletion in a non-repeat region, the variant meets PM4 at moderate strength per generic ACMG/AMP criteria.3 PVS1 is not applicable as this in-frame deletion does not fall into the null-variant buckets (nonsense, frameshift, or canonical splice) defined by the ClinGen SVI PVS1 framework.4 No computational evidence supports pathogenicity (SpliceAI max delta = 0.04; REVEL/BayesDel not applicable to deletions), so PP3 is not met.5 The variant is absent from ClinVar, and no functional studies, cosegregation data, or de novo reports were identified. Multiple criteria (PS2, PS3, PS4, PS5, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5) remain unassessed due to lack of evidence.6

PM2 + PM4 → VUS
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_203407.3 · variants mapped to exon structure
EZHIP NM_203407.3
Fetching transcript structure from UCSC…
Applied criteria · 2 applied · 17 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 2
Strength Supporting Moderate Strong Very strong
PM2 supporting Pathogenic
This variant is extremely rare in population databases. gnomAD v2.1 reports an allele frequency of 0.00135% (2/147,648 alleles, 0 homozygotes). gnomAD v4.1 reports 0.00239% (13/544,257 alleles, 0 homozygotes, grpmax FAF = 2.23 × 10⁻⁵). The variant is absent from gnomAD-Canada. All observed frequencies are well below the 0.1% threshold for PM2 under generic ACMG/AMP.
gnomAD v2.1: AF = 1.35 × 10⁻⁵ (2/147648 alleles)highest subpopulation AF = 8.30 × 10⁻⁵ (East Asian)
PM4 moderate Pathogenic
NM_203407.3:c.860_892del is an in-frame deletion removing 11 amino acids (p.Gly287_Pro297del) within a non-repeat region of EZHIP. In-frame deletions in non-repeat regions meet PM4 at moderate strength under generic ACMG/AMP. The deleted region spans residues 287–297 in exon 1 with no evidence of being a repetitive domain.
In-frame deletion of 11 amino acids (Gly287 to Pro297) in a non-repeat region.
Assessed · not applied · 6 not met · 11 not assessed
Pathogenic
PS2 No de novo data available.
PS3 No variant-specific functional studies identified.
PS4 No case-control or prevalence data available.
PM1 This variant does not lie in a statistically significant mutational hotspot.
PM6 No de novo data available.
PP1 No cosegregation data available.
PP3 No computational evidence supports a deleterious effect.
PP4 No patient phenotype or clinical data were provided for this case.
Benign
BA1 The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BA1 threshold of >1%.
BS1 The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BS1 threshold of >0.3%.
BS2 This variant is observed at extremely low frequency in gnomAD (2 of 147,648 alleles in v2.1; 13 of 544,257 alleles in v4.1) with zero homozygotes.
BS3 No well-established functional studies showing no deleterious effect are available for this variant.
BS4 No segregation data available.
BP2 No data available on whether this variant has been observed in trans with a pathogenic variant or in cis with a pathogenic variant.
BP3 This in-frame deletion spans residues 287–297 in exon 1 of EZHIP.
BP4 SpliceAI predicts no significant splice impact (max delta = 0.04).
BP5 No evidence of an alternate molecular basis for disease was identified in this case.
N/A · 9 PVS1 · PS1 · PM3 · PM5 · PP2 · PP5 · BP1 · BP6 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
This variant is present in gnomAD v4.1 (AF= 2.38858e-05; MAF= 0.00239%, 13/544257 alleles, homozygotes = 0) and has highest observed frequency in the European (non-Finnish) population (AF= 3.99483e-05; MAF= 0.00399%, 12/300388 alleles, homozygotes = 0); grpmax FAF= 2.228e-05.
v2.1
This variant is present in gnomAD v2.1 (AF= 1.35457e-05; MAF= 0.00135%, 2/147648 alleles, homozygotes = 0) and has highest observed frequency in the East Asian population (AF= 8.30496e-05; MAF= 0.00830%, 1/12041 alleles, homozygotes = 0).
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
0.0024% · 13 / 544,257
0 hom · FAF 0.0022%
European (non-Finnish)
12 / 300,388
0.004%
East Asian
1 / 29,804
0.0034%
+ 8 not observed (Remaining individuals, Admixed American, European (Finnish), Amish, Middle Eastern, South Asian, Ashkenazi Jewish, African/African American)
gnomAD v2.1
0.0014% · 2 / 147,648
0 hom
East Asian
1 / 12,041
0.0083%
European (non-Finnish)
1 / 62,387
0.0016%
+ 6 not observed (African/African American, Admixed American, Ashkenazi Jewish, European (Finnish), Remaining individuals, South Asian)
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
This variant is absent from ClinVar.
SpliceAI screenshot
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.04).
Functional / OncoKB screenshot
Functional Unknown Oncogenic Effect
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. EZHIP, a polycomb binding protein, is recurrently altered by rearrangement and mutation in endometrial stromal sarcomas and posterior fossa ependymoma
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots