Sign in

Accounts get 5 interpretations a day, up to 10 a week, while public capacity lasts.

Password

Create an account

Verify your email, then run up to 5 interpretations a day and 10 a week, while public capacity lasts.

First name

Last name optional

Password

At least 10 characters.

I already have an account Why accounts are needed →

Check your email

A verification link is on its way to . Open it to activate your account. The link works for 24 hours.

Nothing after a few minutes? Check spam, or write to info@lyfe-sci.com.

Reset your password

Enter your address and we will send a link to set a new one.

Enter an access code

Codes carry their own allowance and do not need an account. They keep working until their usage is exhausted.

Access code

Your allowance

–

left today

–

left this week

Your account and history

ATGCGTTACGGATCCAGTTCAGGCTAAGCTTGACCATGGCTAGCTTAAGGCCTTAGCATGCAGTTCGGATCCAAGCTTGGCTAAGGCATGCTTAGCCAGTTCGGATCCAAGCTTGACCATGGCTAGCTTAAGGCCTTAGCATGCAGTTCGGATCC

Home / Variants / POT1

Project HERA

POT1 variants

Every POT1 variant the pipeline has interpreted, classified against the ClinGen expert-panel specification for the gene where one exists.

1 variant

POT1 variants

Newest first. Each row opens the full report, criterion by criterion.

1 shown

Variant

Protein change

Classification

POT1 NM_015450.3:c.1884A>C

NP_056265.2:p.(T628=)

Benign

View →

Disclaimer: LYFE Sciences is AI-driven and can make mistakes — double-check the evidence behind each criterion. The content and results provided by LYFE Sciences are for research and educational purposes only and must not be used as a substitute for professional medical judgment, diagnosis, or treatment.

About Terms & conditions Changelog info@lyfe-sci.com