Back
NM_000077.4:c.52_83del
p.Thr18AlafsTer15 · CDKN2A
ACMG/AMP
0%
complete
Final classification
Unclassified
PVS1PM1PM2
CDKN2A
c.52_83del
p.Thr18AlafsTer15
· exon NC_000009.11
This variant

NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 of CDKN2A predicted to produce a truncated protein (p.Thr18AlafsTer15) that removes all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A, meeting PVS1 at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).

Transcript
NM_000077.4
HGVS · transcript:coding
NM_000077.4:c.52_83del
GRCh38
chr9:21974744 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C
GRCh37
chr9:21974743 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C
Classification rationale
PVS1PM1PM2 Unclassified
CDKN2A c.52_83del · exon NC_000009.11

NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 of CDKN2A predicted to produce a truncated protein (p.Thr18AlafsTer15) that removes all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A, meeting PVS1 at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).1 The variant is absent from gnomAD v2.1, v4.1, and Canada population databases, satisfying PM2 at moderate strength.2 The variant completely removes the well-characterized ankyrin-repeat and CDK4/6 binding domains of p16INK4A, meeting PM1 at moderate strength. Published functional studies demonstrate that N-terminal deletions and premature termination mutants of p16INK4A abolish CDK4/6 binding and kinase inhibitory activity.3 No functional study directly tested NM_000077.4:c.52_83del; PS3 is not met. Existing truncation data from PMID:8603820 (deletion constructs) and PMID:8668202 (premature termination mutants) provide domain-level evidence applied under PM1 rather than variant-specific PS3.4 ClinVar classifies this variant as 'Likely oncogenic' (somatic, 1-star single submitter) under variation ID 4539651. This somatic classification and review status do not satisfy PP5 for germline pathogenicity assessment.5 This variant has been reported in somatic cancers (COSMIC COSV58693372, n = 9) and is classified as Likely Oncogenic/Likely Loss-of-function by OncoKB, consistent with a deleterious biological effect.6

PVS1 + PM1 + PM2 Unclassified
1 pvs1_generic_frameworkpvs1_gene_contextpvs1_variant_assessment
3 PMID:8603820PMID:8668202
4 PMID:8603820PMID:8668202
LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
Gene diagram · NM_000077.4 · variants mapped to exon structure
CDKN2A NM_000077.4
Fetching transcript structure from UCSC…
Applied criteria · 3 applied · 17 assessed
MetEvidence satisfies this criterion.
Not metEvaluated against available evidence; threshold not reached.
Not assessedApplies in principle, but no evidence was found to evaluate it.
N/ADoesn't apply to this variant type.
Applied · 3
Strength Supporting Moderate Strong Very strong
PVS1 very strong Pathogenic
NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 predicted to produce a premature termination codon at position 32 (p.Thr18AlafsTer15), removing all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A. Under PMC6185798, frameshift variants in genes with an established loss-of-function disease mechanism meet PVS1 at very strong strength. CDKN2A loss of function is a well-established germline disease mechanism for familial atypical multiple mole melanoma (FAMMM) and pancreatic ductal adenocarcinoma susceptibility. NMD is predicted as the premature termination codon resides >50 nucleotides upstream of the last exon–exon junction.
Frameshift variant producing premature termination at codon 32 of 156 (NP_000068.1:p.(Thr18AlafsTer15))CDKN2A loss-of-function mechanism supported by germline literature (PMC6185798 framework)All four ankyrin-repeat domains and CDK4/6 binding region removed
PM1 moderate Pathogenic
NM_000077.4:c.52_83del creates a premature termination at codon 32, completely removing all four ankyrin-repeat domains (aa ~11-43, ~44-76, ~77-110, ~111-142) and the CDK4/6 binding region of p16INK4A, which are well-characterized functional domains critical for tumor suppressor activity. Under the PM1 domain-level rule, variants that remove or disrupt a critical functional domain characterized in the literature satisfy PM1.
All four ankyrin repeats and CDK4/6 binding region removed by premature truncation at codon 32PMID:8603820: the core region (aa 73-131) plus N-terminal sequences are essential for CDK4 inhibitory activityconstructs lacking the N-terminus (9-72
PM2 moderate Pathogenic
NM_000077.4:c.52_83del is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0 population databases. Under the non-VCEP generic ACMG framework, absence from population databases (allele frequency < 0.1%) satisfies PM2 at moderate strength.
Absent from gnomAD v2.1 (exomes)Absent from gnomAD v4.1 (exomes)Absent from gnomAD-Canada v1.0 (genomes)
Assessed · not applied · 17 not met · 0 not assessed
Pathogenic
PS2 No de novo observation of NM_000077.4:c.52_83del has been reported in any reviewed publication or database.
PS3 No functional study directly tested NM_000077.4:c.52_83del.
PS4 No case-control data comparing the prevalence of NM_000077.4:c.52_83del in affected individuals versus controls has been reported.
PM6 No de novo observation of NM_000077.4:c.52_83del has been reported.
PP1 No cosegregation data are available for NM_000077.4:c.52_83del.
PP3 In silico prediction tools applicable to this variant type do not provide evidence of deleterious effect.
PP4 No patient phenotype or clinical data are available for NM_000077.4:c.52_83del.
PP5 ClinVar variation ID 4539651 classifies this variant as 'Likely oncogenic' with a review status of 'criteria provided, single submitter' (1-star).
Benign
BA1 NM_000077.4:c.52_83del is absent from gnomAD v2.1, v4.1, and Canada population databases.
BS1 NM_000077.4:c.52_83del is absent from gnomAD population databases.
BS2 No data are available regarding observation of NM_000077.4:c.52_83del in healthy adult individuals.
BS3 No functional study demonstrates that NM_000077.4:c.52_83del has no deleterious effect.
BS4 No nonsegregation data are available for NM_000077.4:c.52_83del.
BP2 No data are available regarding the observation of NM_000077.4:c.52_83del in trans with a known pathogenic CDKN2A variant.
BP4 BP4 requires multiple lines of computational evidence suggesting no impact on the gene or gene product.
BP5 No data are available indicating that NM_000077.4:c.52_83del is found in a case with an alternative molecular basis for disease.
BP6 ClinVar classifies NM_000077.4:c.52_83del as 'Likely oncogenic' (somatic), not as 'Benign' or 'Likely Benign.' BP6 requires a reputable source to report the variant as benign, which is not the case.
N/A · 8 PS1 · PM3 · PM4 · PM5 · PP2 · BP1 · BP3 · BP7
Research & evidence
Population frequency
gnomAD v4.1 screenshot
gnomAD v4.1
gnomAD v2.1 screenshot
gnomAD v2.1
v4.1
Absent from gnomAD v4.1.
v2.1
Absent from gnomAD v2.1.
🇨🇦 CA
Absent from gnomAD-Canada v1.0.
Allele frequency by ancestry
three datasets · side by side
gnomAD v4.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD v2.1
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
gnomAD Canada 🇨🇦
Absent · 0 / ?
0 hom
Not observed in any ancestry group.
ClinVar screenshot
ClinVar
In progress — evidence not uploaded yet.
SpliceAI screenshot
In silico
In progress — evidence not uploaded yet.
Functional / OncoKB screenshot
Functional Likely Oncogenic
In progress — evidence not uploaded yet.
OncoKB ↗
COSMIC screenshot
COSMIC
Cancer hotspots screenshot
Cancer hotspots
Somatic evidence Not in COSMIC / hotspots
COSMIC
In progress — evidence not uploaded yet.
Hotspots
This variant does not lie in a statistically significant hotspot.
Sources & reference links
8Sources
ClinVar
gnomAD v2.1
gnomAD v4.1
gnomAD-Canada
SpliceAI
OncoKB
COSMIC
Cancer hotspots
Triaged references · 7 PMIDs not cited in assessment
8603820 ↗ Cancer-associated mis-sense and deletion mutations impair p16INK4 CDK inhibitory activity. ONCOKB
8668202 ↗ Temperature-sensitive mutants of p16CDKN2 associated with familial melanoma. ONCOKB
29533785 ↗ Systematic Functional Annotation of Somatic Mutations in Cancer. CLINVAR
35001868 ↗ Functional CDKN2A assay identifies frequent deleterious alleles misclassified as variants of uncertain significance. CLINVAR
22918138 ↗ Opportunities and challenges associated with clinical diagnostic genome sequencing: a report of the Association for Molecular Pathology. CLINVAR
34131312 ↗ Chromosomal microarray analysis, including constitutional and neoplastic disease applications, 2021 revision: a technical standard of the American College of Medical Genetics and Genomics (ACMG). CLINVAR
23619274 ↗ American College of Medical Genetics and Genomics technical standards and guidelines: microarray analysis for chromosome abnormalities in neoplastic disorders. CLINVAR